Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Probes and conditions used in the polymerase chain reaction to genotype interleukin 6 single nucleotide polymorphism at position-174 (rs1800795)
| IL-6 Gene-174 (rs1800795) | |
| ACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA | 60 ºC–1 min; 95 ºC–10 min; 50 cycles (95 ºC–15 s, 60 ºC–90 s) and 60 ºC–1 min |
IL-6: Interleukin 6.
