REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal anti-beta-actin	Cell Signaling Technology	Cat# 4967; RRID: AB_10695744
Rabbit polyclonal anti-Akt antibody	Cell Signaling Technology	Cat# 9272; RRID: AB_329827
Rabbit monoclonal anti-phospho-Akt (Ser473)	Cell Signaling Technology	Cat# 4060; RRID: AB_2315049
Rabbit polyclonal anti-PRAS40	Cell Signaling Technology	Cat# 2610; RRID: AB_916206
Rabbit monoclonal anti-phospho-PRAS40 (Thr246)	Cell Signaling Technology	Cat# 2997; RRID: AB_2258110
Mouse monoclonal anti-S6 Ribosomal Protein	Cell Signaling Technology	Cat# 2317; RRID: AB_2238583
Rabbit polyclonal anti-phospho-S6 Ribosomal Protein (Ser235/236)	Cell Signaling Technology	Cat# 2211; RRID: AB_331679
Rabbit polyclonal anti-NDRG1	Cell Signaling Technology	Cat# 5196; RRID: AB_10626626
Rabbit monoclonal anti-phospho-NDRG1 (Thr376)	Cell Signaling Technology	Cat# 5482; RRID: AB_10693451
Rabbit polyclonal anti-Raptor	Cell Signaling Technology	Cat# 2280; RRID: AB_561245
Rabbit polyclonal anti-Rictor	Cell Signaling Technology	Cat# 2140; RRID: AB_2179961
Rabbit monoclonal anti-mTOR	Cell Signaling Technology	Cat# 2983; RRID: AB_2105622
Rabbit polyclonal anti-P70 S6 Kinase	Cell Signaling Technology	Cat# 9202; RRID: AB_331676
Rabbit polyclonal anti-phospho-p70 S6 Kinase (Thr389)	Cell Signaling Technology	Cat# 9205; RRID: AB_330944
Rabbit polyclonal anti-4E-BP1 (53H11)	Cell Signaling Technology	Cat# 9644; RRID: AB_2097841
Rabbit polyclonal anti-phospho-4E-BP1 (Ser65)	Cell Signaling Technology	Cat# 9451; RRID: AB_330947
Rabbit monoclonal anti-Lamin B1 (D4Q4Z)	Cell Signaling Technology	Cat# 12586; RRID: AB_2650517
Rabbit polyclonal anti-phospho-PKC (pan) (βII Ser660)	Cell Signaling Technology	Cat# 9371; RRID: AB_2168219
Rabbit polyclonal anti-PKCdelta	Cell Signaling Technology	Cat# 2058; RRID: AB_10694655
Rabbit polyclonal anti-phospho-PKCdelta/theta (Ser643/676)	Cell Signaling Technology	Cat# 9376; RRID: AB_2168834
Rabbit polyclonal anti-RKIP (G38)	Cell Signaling Technology	Cat# 5060; RRID: AB_1904081
Rabbit polyclonal anti-c-Raf	Cell Signaling Technology	Cat# 9422; RRID: AB_390808
Rabbit monoclonal anti-phospho-c-Raf (Ser338)	Cell Signaling Technology	Cat# 9427; RRID: AB_2067317
Rabbit polyclonal anti-MEK1/2	Cell Signaling Technology	Cat# 9122; RRID: AB_823567
Rabbit polyclonal anti-phospho-MEK1/2 (Ser217/Ser221)	Cell Signaling Technology	Cat# 9121; RRID: AB_331648
Rabbit polyclonal anti-p44/42 MAPK (Erk1/2)	Cell Signaling Technology	Cat# 9102; RRID: AB_330744
Rabbit polyclonal anti-phospho-p44/42 MAPK (Thr202/Tyr204)	Cell Signaling Technology	Cat# 9101; RRID: AB_331646
Rabbit polyclonal anti-p38 MAPK	Cell Signaling Technology	Cat# 9212; RRID: AB_330713
Rabbit polyclonal anti-phospho-p38 MAPK (Thr180/Tyr182)	Cell Signaling Technology	Cat# 9211; RRID: AB_331641
Rabbit polyclonal anti-cPLA2	Cell Signaling Technology	Cat# 2832; RRID: AB_2164442
Rabbit polyclonal anti-phospho-cPLA2 (Ser505)	Cell Signaling Technology	Cat# 2831; RRID: AB_2164445
Rabbit monoclonal anti-HA-Tag	Cell Signaling Technology	Cat# 3724; RRID: AB_1549585
Rabbit monoclonal anti-GAPDH	Cell Signaling Technology	Cat# 2118; RRID: AB_561053
Rabbit polyclonal anti-PLCgamma1	Cell Signaling Technology	Cat# 2822; RRID: AB_2163702
Rabbit polyclonal anti-phospho-PLCgamma1 (Tyr783)	Cell Signaling Technology	Cat# 2821; RRID: AB_330855
Rabbit polyclonal anti-phospho-threonine	Cell Signaling Technology	Cat# 9381; RRID: AB_330301
Rabbit polyclonal anti-IkBalpha	Cell Signaling Technology	Cat# 9242; RRID: AB_331623
Rabbit monoclonal anti-phospho-IkBalpha (Ser32)	Cell Signaling Technology	Cat# 2859; RRID: AB_561111
Rabbit monoclonal anti-Stat3	Cell Signaling Technology	Cat# 4904; RRID: AB_331269
Rabbit polyclonal anti-phospho-Stat3 (Ser727)	Cell Signaling Technology	Cat# 9134; RRID: AB_331589
Rabbit monoclonal anti-PKD/PKCμ	Cell Signaling Technology	Cat# 90039; RRID: AB_2800149
Rabbit polyclonal anti-phospho-PKD/PKCμ (Ser744/748)	Cell Signaling Technology	Cat# 2054; RRID: AB_2172539
Mouse monoclonal anti-Rb (4H1)	Cell Signaling Technology	Cat# 9309; RRID: AB_823629
Rabbit monoclonal anti-estrogen inducible protein pS2	Abcam	Cat# ab92377; RRID: AB_10562122
Rabbit polyclonal anti-PKCzeta	Abcam	Cat# ab59364; RRID: AB_944858
Rabbit monoclonal anti-phospho-PKCzeta (Thr560)	Abcam	Cat# ab62372; RRID: AB_946309
Rabbit polyclonal anti-PKCepsilon	Abcam	Cat# ab63638; RRID: AB_1142276
Rabbit polyclonal anti-phospho-PKCepsilon (Ser729)	Abcam	Cat# ab63387; RRID: AB_1142277
Rabbit monoclonal anti-secretory phospholipase A2	Abcam	Cat# ab139692
Mouse monoclonal anti-PKCbeta II (F-7)	Santa Cruz Biotechnology	Cat# sc-13149; RRID: AB_628144
Mouse monoclonal anti-PKCzeta (B-7)	Santa Cruz Biotechnology	Cat# sc-393218
Mouse monoclonal anti-phospho-RKIP (Ser153)	Santa Cruz Biotechnology	Cat# sc-135779; RRID: AB_2163163
Normal rabbit IgG	Santa Cruz Biotechnology	Cat# sc-2027; RRID: AB_737197
Mouse monoclonal anti-phospho-Rb (Thr821/826)	Santa Cruz Biotechnology	Cat# sc-271930; RRID: AB_670923
Rabbit polyclonal anti-phospholipase A2 (iPLA2)	Sigma-Aldrich	Cat# SAB4200129; RRID: AB_11129638
Rabbit monoclonal anti-phospho-PKCzeta (Thr410)	Thermo Fisher Scientific	Cat# MA5-15060; RRID: AB_10983263
Mouse monoclonal anti-SREBP1	BD Biosciences	Cat#557036; RRID: AB_396559
Goat anti-rabbit IgG (H+L)-HRP conjugate	Bio-Rad	Cat#170-6515; RRID: AB_11125142
Goat anti-mouse IgG (H+L)-HRP conjugate	Bio-Rad	Cat#170-6516; RRID: AB_11125547
Mouse polyclonal anti-Nkp46/ncr1	R and D systems	Cat#AF2225; RRID: AB_355192
Rabbit monoclonal anti-Ki-67 (D3B5)	Cell Signaling Technology	Cat# 9129; RRID: AB_2687446
Goat anti-Mouse IgG (H+L) secondary antibody, Alexa Fluor 546	Thermo Fisher Scientific	Cat# A-11003; RRID: AB_2534071
Phalloidin-iFluor 633	Abcam	Cat# ab176758
Rabbit polyclonal anti-phospho-cPLA2 (Thr376) (Peptide name: PLA2G4A-369:383-pT376)	This paper (produced by Thermo Fisher Scientific)	Cat# UE1820P-T-AB1792
Bacterial and Virus Strains
MAX Efficiency DH5α Competent Cells	Thermo Fisher Scientific	Cat#18258012
Biological Samples
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB180
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB83
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB092
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB519
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB512
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB367
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB541
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB383
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB323
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB210
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB334
Primary human breast tissue	Imperial College Tissue Bank	Cat# IKB283
Breast PDX model	CrownBioscience	Cat# BR6695
Breast PDX model	CrownBioscience	Cat# BR5020
Breast PDX model	CrownBioscience	Cat# BR5009
Breast PDX model	CrownBioscience	Cat# BR5022
Breast PDX model	CrownBioscience	Cat# BR1282
Breast PDX model	CrownBioscience	Cat# BR5011
Breast PDX model	CrownBioscience	Cat# BR5014
Breast PDX model	CrownBioscience	Cat# BR5012
Breast PDX model	CrownBioscience	Cat# BR5017
Breast PDX model	CrownBioscience	Cat# BR5013
Breast PDX model	CrownBioscience	Cat# BR1474
Breast PDX model	CrownBioscience	Cat# BR3267
Breast PDX model	CrownBioscience	Cat# BR5010
Breast PDX model	CrownBioscience	Cat# BR5015
Breast PDX model	CrownBioscience	Cat# BR5337
Breast PDX model	CrownBioscience	Cat# BR1115
Breast PDX model	CrownBioscience	Cat# BR1283
Breast PDX model	CrownBioscience	Cat# BR1458
Breast PDX model	Champions Oncology	Cat# CTG1059
Breast PDX model	Champions Oncology	Cat# CTG1350
Breast PDX model	Champions Oncology	Cat# CTG1941
Breast PDX model	Champions Oncology	Cat# CTG2308
Breast PDX model	Champions Oncology	Cat# CTG0033
Breast PDX model	Champions Oncology	Cat# CTG0012
Breast PDX model	Champions Oncology	Cat# CTG0017
Breast PDX model	Champions Oncology	Cat# CTG0018
Breast PDX model	Champions Oncology	Cat# CTG0437
Breast PDX model	Champions Oncology	Cat# CTG0473
Ovarian PDX model	Champions Oncology	Cat# CTG0253
Ovarian PDX model	Champions Oncology	Cat# CTG1423
Ovarian PDX model	Champions Oncology	Cat# CTG1602
Ovarian PDX model	Champions Oncology	Cat# CTG1627
Ovarian PDX model	Champions Oncology	Cat# CTG0252
Ovarian PDX model	Champions Oncology	Cat# CTG0258
Ovarian PDX model	Champions Oncology	Cat# CTG0259
Ovarian PDX model	Champions Oncology	Cat# CTG0486
Pancreatic PDX model	Champions Oncology	Cat# CTG0292
Pancreatic PDX model	Champions Oncology	Cat# CTG0381
Pancreatic PDX model	Champions Oncology	Cat# CTG0391
Pancreatic PDX model	Champions Oncology	Cat# CTG1485
Pancreatic PDX model	Champions Oncology	Cat# CTG2205
Pancreatic PDX model	Champions Oncology	Cat# CTG0282
Pancreatic PDX model	Champions Oncology	Cat# CTG0283
Pancreatic PDX model	Champions Oncology	Cat# CTG0284
Pancreatic PDX model	Champions Oncology	Cat# CTG0285
Pancreatic PDX model	Champions Oncology	Cat# CTG0286
Sarcoma PDX model	Champions Oncology	Cat# CTG0886
Sarcoma PDX model	Champions Oncology	Cat# CTG1084
Sarcoma PDX model	Champions Oncology	Cat# CTG1116
Sarcoma PDX model	Champions Oncology	Cat# CTG1255
Sarcoma PDX model	Champions Oncology	Cat# CTG1628
Sarcoma PDX model	Champions Oncology	Cat# CTG0142
Sarcoma PDX model	Champions Oncology	Cat# CTG0143
Sarcoma PDX model	Champions Oncology	Cat# CTG0241
Sarcoma PDX model	Champions Oncology	Cat# CTG0242
Sarcoma PDX model	Champions Oncology	Cat# CTG0243
Colorectal PDX model	Champions Oncology	Cat# CTG0083
Colorectal PDX model	Champions Oncology	Cat# CTG0129
Colorectal PDX model	Champions Oncology	Cat# CTG0360
Colorectal PDX model	Champions Oncology	Cat# CTG0706
Colorectal PDX model	Champions Oncology	Cat# CTG0799
Colorectal PDX model	Champions Oncology	Cat# CTG0058
Colorectal PDX model	Champions Oncology	Cat# CTG0062
Colorectal PDX model	Champions Oncology	Cat# CTG0063
Colorectal PDX model	Champions Oncology	Cat# CTG0065
Colorectal PDX model	Champions Oncology	Cat# CTG0066
Chemicals, Peptides, and Recombinant Proteins
Hydrocortisone	Sigma-Aldrich	Cat# H-0888
Insulin-transferrin-selenium	GIBCO	Cat# 41400-045
Epidermal growth factor (EGF)	Peprotech	Cat# AF-100-15
Cholera toxin	Sigma-Aldrich	Cat# C-8052
Insulin	Sigma-Aldrich	Cat# I-1882
Fatty acid free bovine serum albumin	Sigma-Aldrich	Cat# A8806
PKC zeta pseudosubstrate inhibitory peptide	Sigma-Aldrich	Cat# P1614
PKC beta II peptide inhibitor	Sigma-Aldrich	Cat# P-0102
FIPI hydrochloride hydrate	Sigma-Aldrich	Cat# F5808
4-hydroxytamoxifen	Sigma-Aldrich	Cat# T176
Bromoenol lactone	Sigma-Aldrich	Cat# B1552
Cycloheximide	Sigma-Aldrich	Cat# C7698
Doxycycline hyclate	Sigma-Aldrich	Cat# D9891
Arachidonic acid	Sigma-Aldrich	Cat# 10931
Palmitoleate	Sigma-Aldrich	Cat# P9417
Palmitate	Sigma-Aldrich	Cat# P0500
PKC alpha (C2-4) inhibitor peptide	Santa Cruz Biotechnology	Cat# sc-304
PKC epsilon inhibitor peptide	Cambridge Bioscience	Cat# CAY17476
Rapamycin	Selleckchem	Cat# S1039
Torin 1	Selleckchem	Cat#S2827
BYL719	Selleckchem	Cat# S2814
BKM120	Selleckchem	Cat# 2247
MK2206	Selleckchem	Cat# S1078
GSK690693	Selleckchem	Cat# S1113
GSK650394	Tocris Bioscience	Cat# 3572
U73122	Tocris Bioscience	Cat# 1268
ASB14780	Axon Medchem	Cat# 2578
DharmaFECT-1 transfection reagent	Dharmacon	Cat# T-2001-02
FuGENE HD Transfection reagent	Promega	Cat# E2311
Lipid Removal Adsorbent	Supelco	Cat# 13358
Matrigel	Corning	Cat# 354230
Paraformaldehyde	Sigma-Aldrich	Cat# 158127
Triton X-100	Sigma-Aldrich	Cat# X100
DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride)	Thermo Fisher Scientific	Cat# D1306
RIPA buffer	Thermo Fisher Scientific	Cat# 89900
Leupeptin	Sigma-Aldrich	Cat# L2884
Pepstatin	Sigma-Aldrich	Cat# P5318
Na3VO4	Sigma-Aldrich	Cat# 450243
DL-Dithiothreitol	Sigma-Aldrich	Cat# 646653
Calyculin A	Cell Signaling Technology	Cat# 9902
Beta-glycerophosphate	Sigma-Aldrich	Cat# G9422
PMSF protease inhibitor	Cell Signaling Technology	Cat# 8553
Bradford reagent	Bio-Rad	Cat# 5000006
ALLN protease inhibitor	Merck-Millipore	Cat# 208719
2x Laemmli sample buffer	Bio-Rad	Cat# 161-0737
4x Laemmli sample buffer	Bio-Rad	Cat# 161-0747
10X Cell lysis buffer	Cell Signaling Technology	Cat# 9803
Recombinant human protein kinase C zeta	Insight Biotechnology	Cat# TP302472
Recombinant human phospholipase A2, group IVA	Insight Biotechnology	Cat# TP320972
Magnesium chloride	Sigma-Aldrich	Cat# M8266
Bovine serum albumin	Sigma-Aldrich	Cat# A2153
Puromycin	Invivogen	Cat# ant-pr-1
Blasticidin	Invivogen	Cat# ant-bl-1
Critical Commercial Assays
QuikChange Lightning Site-Directed Mutagenesis Kit	Agilent	Cat# 210518
CellTiter96 Aqueous Non-radioactive (MTS) cell proliferation assay	Promega	Cat# G5430
Fatty Acid Uptake Kit	Sigma-Aldrich	Cat# MAK156
Cytosolic Phospholipase A2 Assay Kit	Abcam	Cat# ab133090
Secretory Phospholipase A2 Assay Kit	Abcam	Cat# ab133089
Diacylglycerol (DAG) Assay Kit	Cell Biolabs Inc	Cat# MET-5028
Active Rac1 Detection Kit	Cell Signaling Technology	Cat# 8815
Duolink In Situ Detection Reagents Red Kit	Sigma-Aldrich	Cat# DUO92008
Minus and Plus PLA probes	Sigma-Aldrich	Cat# DUO92004 and DUO92002
Fluo-4 Direct Calcium Assay Kit	Thermo Fisher Scientific	Cat# F10471
RNeasy Plus Mini Kit	QIAGEN	Cat# 74134
QuantiTect Reverse Transcription Kit	QIAGEN	Cat#205311
SYBR Select Master Mix	Thermo Fisher Scientific	Cat# 4472908
QIAamp DNA mini kit	QIAGEN	Cat# 51304
PNAClamp PIK3CA Mutation Detection Kit	Panagene	Cat# PNAC-4001
ADP-Glo Kinase Assay	Promega	Cat# V6930
Arachidonic Acid ELISA Kit	Generon	Cat# CEB098Ge
Prostaglandin E2 ELISA Kit	Enzo Life Sciences	Cat# ADI-900-001
Mouse RANTES (CCL5) ELISA Kit	Abcam	Cat# ab100739
Mouse Fractalkine (CX3CL1) ELISA Kit	Abcam	Cat# ab100683
Pierce BCA Protein Assay Kit	Thermo Fisher Scientific	Cat# 23225
Deposited Data
Custom script for quantification of proximity ligation assay images	This manuscript	Github: https://github.com/adamltyson/foci2D
Custom script for quantification of acini images	This manuscript	Github: https://github.com/adamltyson/cell-coloc-3D
Custom script for quantification of calcium flux	This manuscript	Github: https://github.com/adamltyson/CalciumAnalysis
REIMS data for Figure 1D	This manuscript	Mendeley Data; https://doi.org/10.17632/xcgc5kpntm.1
REIMS data for Figure 1E	This manuscript	Mendeley Data; https://doi.org/10.17632/xcgc5kpntm.1
REIMS data for Figure 1H	This manuscript	Mendeley Data; https://doi.org/10.17632/xcgc5kpntm.1
REIMS data for Figure 3B	This manuscript	Mendeley Data; https://doi.org/10.17632/xcgc5kpntm.1
REIMS data for Figure 3D	This manuscript	Mendeley Data; https://doi.org/10.17632/xcgc5kpntm.1
Significantly altered phospholipids across breast cancer cell lines of different receptor, or triple negative status	This manuscript	Table S1
Significantly different fatty acids between MCF10A PIK3CA wild-type and E545K/H1047R mutant cells	This manuscript	Table S4
Experimental Models: Cell Lines
Human PIK3CA (H1047R/+) MCF10A	Horizon Discovery	Cat# HD 101-011
Human PIK3CA (E545K/+) MCF10A	Horizon Discovery	Cat# HD 101-002
AU565 (human breast carcinoma)	ATCC	Cat# CRL-2351; RRID: CVCL_1074
BT20 (human breast carcinoma)	ATCC	Cat# HTB-19; RRID: CVCL_0178
BT474 (human breast carcinoma)	ATCC	Cat# HTB-20; RRID: CVCL_0179
BT549 (human breast carcinoma)	ATCC	Cat# HTB-122; RRID: CVCL_1092
CAL51 (human breast carcinoma)	DSMZ	Cat# ACC-302; RRID: CVCL_1110
CAMA1 (human breast carcinoma)	ATCC	Cat# HTB-21; RRID: CVCL_1115
EFM19 (human breast carcinoma)	DSMZ	Cat# ACC-231; RRID: CVCL_0253
Hs578T (human breast carcinoma)	ATCC	Cat# HTB-126; RRID: CVCL_0332
JIMT1 (human breast carcinoma)	DSMZ	Cat# ACC-589; RRID: CVCL_2077
KPL1 (human breast carcinoma)	DSMZ	Cat# ACC-317; RRID: CVCL_2094
MCF7 (human breast carcinoma)	ATCC	Cat# HTB-22; RRID: CVCL_0031
MDAMB134 (human breast carcinoma)	ATCC	Cat# HTB-23; RRID: CVCL_0617
MDAMB157 (human breast carcinoma)	ATCC	Cat# HTB-24; RRID: CVCL_0618
MDAMB231 (human breast carcinoma)	ATCC	Cat# HTB-26; RRID: CVCL_0062
MDAMB361 (human breast carcinoma)	ATCC	Cat# HTB-27; RRID: CVCL_0620
MDAMB436 (human breast carcinoma)	ATCC	Cat# HTB-130; RRID: CVCL_0623
MDAMB453 (human breast carcinoma)	ATCC	Cat# HTB-131; RRID: CVCL_0418
MDAMB468 (human breast carcinoma)	ATCC	Cat# HTB-132; RRID: CVCL_0419
MFM223 (human breast carcinoma)	DSMZ	Cat# ACC-422; RRID: CVCL_1408
S68 (human breast carcinoma)	Breast Cancer Now (Institute of Cancer Research)	RRID: CVCL_5585
SKBR3 (human breast carcinoma)	ATCC	Cat# HTB-30; RRID: CVCL_0033
T47D (human breast carcinoma)	ATCC	Cat# HTB-133; RRID: CVCL_0553
UACC812 (human breast carcinoma)	ATCC	Cat# CRL-1897; RRID: CVCL_1781
VP229 (human breast carcinoma)	Breast Cancer Now (Institute of Cancer Research)	RRID: CVCL_2754
BT483 (human breast carcinoma)	ATCC	Cat# HTB-121; RRID: CVCL_2319
HCC1143 (human breast carcinoma)	ATCC	Cat# CRL-2321; RRID: CVCL_1245
HCC1395 (human breast carcinoma)	ATCC	Cat# CRL-2324; RRID: CVCL_1249
HCC1428 (human breast carcinoma)	ATCC	Cat# CRL-2327; RRID: CVCL_1252
HCC1500 (human breast carcinoma)	ATCC	Cat# CRL-2329; RRID: CVCL_1254
HCC1569 (human breast carcinoma)	ATCC	Cat# CRL-2330; RRID: CVCL_1255
HCC1937 (human breast carcinoma)	ATCC	Cat# CRL-2336; RRID: CVCL_0290
HCC1954 (human breast carcinoma)	ATCC	Cat# CRL-2338; RRID: CVCL_1259
HCC202 (human breast carcinoma)	ATCC	Cat# CRL-2316; RRID: CVCL_2062
HCC38 (human breast carcinoma)	ATCC	Cat# CRL-2314; RRID: CVCL_1267
HCC70 (human breast carcinoma)	ATCC	Cat# CRL-2315; RRID: CVCL_1270
SUM52 (human breast carcinoma)	Breast Cancer Now (Institute of Cancer Research)	RRID: CVCL_3425
ZR751 (human breast carcinoma)	ATCC	Cat# CRL-1500; RRID: CVCL_0588
ZR7530 (human breast carcinoma)	ATCC	Cat# CRL-1504; RRID: CVCL_1661
SUM44 (human breast carcinoma)	Breast Cancer Now (Institute of Cancer Research)	RRID: CVCL-3424
SUM159 (human breast carcinoma)	Breast Cancer Now (Institute of Cancer Research)	RRID: CVCL_5423
SUM149 (human breast carcinoma)	Breast Cancer Now (Institute of Cancer Research)	RRID: CVCL_3422
SUM225 (human breast carcinoma)	Breast Cancer Now (Institute of Cancer Research)	RRID: CVCL_5593
SUM229 (human breast carcinoma)	Breast Cancer Now (Institute of Cancer Research)	RRID: CVCL_5594
HEK293T (human embryonic kidney)	ATCC	Cat# CRL-3216; RRID: CVCL_0063
Human MCF10A PIK3CA WT CRISPR control cell line	This manuscript	N/A
Human MCF10A PIK3CA WT cPLA2 CRISPR cell line	This manuscript	N/A
Human MCF10A PIK3CA H1047R (+/) CRISPR control cell line	This manuscript	N/A
Human MCF10A PIK3CA H1047R (+/−) cPLA2 CRISPR cell line	This manuscript	N/A
Experimental Models: Organisms/Strains
Mouse: BALB/c nude (female, age: 6–8 weeks)	Beijing Anikeeper Biotech (Beijing, China)	N/A
Mouse: BALB/c nude (female, age: 7–9 weeks)	Envigo	N/A
Oligonucleotides
Primers for cPLA2 shRNA amplification (Forward 5′-GTGGAAAGGACGAAACACCGGT-3′, Reverse 5′-TTTGTCTCGAGGTCGAGAATTC-3′	Sigma-Aldrich	N/A
Mutagenesis primers to generate cPLA2 S505A (Forward 5′-GCAAAGTCACTCAAAGGAGCCAGTG GATAAGATGTATTG-3′, Reverse 5′-CAATACATCTTATCCACTGGCTCCTTT GAGTGACTTTGC-3′	Sigma-Aldrich	N/A
Mutagenesis primers to generate cPLA2 T376A (Forward 5′-TTCTTC ATACTTCTTAACGACTGCTCCCATAAAAA ATTTGCTTCCAA-3′, Reverse 5′-TTGGAAGCAAATTT TTTATGGGAGCAGTCGTTAAG AAGTATGAAGAA-3′	Sigma-Aldrich	N/A
qPCR primers for human cPLA2 (PLA2G4A) (Forward 5′-GATGAAACTCTAGGGACAGCAAC-3′, Reverse 5′-CTGGGCATGAGCAAACTTCAA-3′	Sigma-Aldrich	N/A
qPCR primers for human beta-actin (Forward 5′-GACCCAGATCATGTTTGAGACC-3′, Reverse 5′-CTTCATGAGGTAGTCAGTCAGG-3′)	Sigma-Aldrich	N/A
Recombinant DNA
pLKO-Tet-On Vector	Wiederschain et al., 2009	Addgene ID: 21915
pCMV3-HA-PLA2G4A	Sino Biological	Cat# HG13126-NY
RICTOR ON-TARGETplus SMARTPool human siRNA	Dharmacon	Cat# L-016984-00-0005
RAPTOR ON-TARGETplus SMARTPool human siRNA	Dharmacon	Cat# L-004107-00-0005
FRAP1 ON-TARGETplus SMARTPool human siRNA	Dharmacon	Cat# L-003008-00-0005
PLCγ1 ON-TARGETplus SMARTPool human siRNA	Dharmacon	Cat# L-003559-00-0005
PRKCZ ON-TARGETplus SMARTPool human siRNA	Dharmacon	Cat# L-003526-00-0005
Non-targeting siRNA control	Dharmacon	Cat# D-001810-01-05
TRC Lentiviral eGFP shRNA positive control	Dharmacon	Cat# RHS4459
TRC Lentiviral Human PLA2G4A shRNA 1	Dharmacon	Cat# TRCN0000050263
TRC Lentiviral Human PLAG2G4A shRNA 5	Dharmacon	Cat# TRCN0000050267
LentiCRISPR v2	Sanjana et al., 2014	Addgene ID: 52961
PLA2G4A sgRNA CRISPR/Cas9 All-in-One Lentivector Target 2	Applied Biological Materials	Cat# K1659207
pCMV-HA-PLA2G4A-S505A	This manuscript	N/A
pCMV-HA-PLA2G4A-T376A	This manuscript	N/A
Inducible pLKO-Tet-On-TRC Lentiviral Human PLA2G4A shRNA 1	This manuscript	N/A
Software and Algorithms
R statistical software (version 3.5.1)	The R Project	https://www.r-project.org/
ProteoWizard MsConvert software (version 3.0.11781)	Chambers et al., 2012	http://proteowizard.sourceforge.net/download.html
MALDIquant package	Gibb and Strimmer, 2012	https://cran.r-project.org/web/packages/MALDIquant/index.html
ReactomePA package	Yu and He, 2016	https://bioconductor.org/packages/release/bioc/html/ReactomePA.html
MATLAB (2014a, version 8.3.0.532)	Mathworks	https://www.mathworks.com/products/matlab.html
GraphPad Prism (version 8.0.1)	GraphPad	https://www.graphpad.com/scientific-software/prism/
Database for Annotation, Visualization and Integrated Discovery (DAVID, version 6.8)	Huang et al., 2009	https://david.ncifcrf.gov/
TargetLynx software	Waters Corporation	https://www.waters.com/waters/home.htm
Image Lab Software (version 5.2.1)	Bio-Rad	https://www.bio-rad.com/en-uk/product/image-lab-software?ID=KRE6P5E8Z
ImageJ (version 1.51)	NIH	https://imagej.nih.gov/ij/download.html
Other
Protein G Sepharose beads	Sigma-Aldrich	Cat# P3296
Dulbecco’s Modified Eagle’s Medium (DMEM)	GIBCO	Cat# 41965-039
Roswell Park Memorial Institute (RPMI) 1640	GIBCO	Cat# 10220-106
Ham’s F12 media	Thermo Fisher Scientific	Cat# 11765054
DMEM/F-12	GIBCO	Cat# 31330-038
Horse Serum	Thermo Fisher Scientific	Cat# 16050-122
4–15% Criterion TGX Precast Midi Protein Gel	Bio-Rad	Cat# 5671084
4–15% Mini-PROTEAN TGX Precast Protein Gel	Bio-Rad	Cat# 4561083
Electrosurgical bipolar forceps	Erbe Elektromedizin (Germany)	N/A
ForceTriad electrosurgical unit	Covidien (Ireland)	N/A
Thermo Exactive orbitrap instrument	Thermo Scientific	N/A
Waters HSS T3 UPLC column	Waters Corporation	Cat# 186005614
Waters Xevo TQ-S triple quadrupole mass spectrometer	Waters Corporation	N/A
Normal diet (for PDX study)	Keaoxieli Feed (Beijing, China)	Cat# 2152
Fat free diet (for PDX study)	Xietong Organism (Beijing, China)	Cat# RD17112401
Western diet (omega-3/omega-6 = 1:50) (For cell line xenograft study)	Research Diets	Cat# D19032707
Balanced diet (omega-3/omega-6 = 1:1) (For cell line xenograft study)	Research Diets	Cat# D19032708
Fat free diet (For xenograft study)	Research Diets	Cat# D19032705
Precellys Lysing Soft tissue homogenizing kit	Precellys	Cat# P000912-LYSK0
Precellys24 homogenizer	Bertin Instruments	Cat# P000669-PR240-A