Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2020 Jul 7;10:11139. doi: 10.1038/s41598-020-68014-1

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© The Author(s) 2020

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

PMC Copyright notice

Northern blot analyses of T0 DvSSJ1 root samples. (A) Northern blots of eight DvSSJ1 dsRNA events and a non-transgenic control (NTC). A top diagram illustrates the dsRNA expression cassette. Zm-actin (Accession #: EU952376) was included as a reference gene for northern analysis (top panel). Plants containing 210 bp DvSSJ1 cassette expressed both long dsRNA transcripts (middle panel) and siRNAs (bottom panel). There were two long dsRNA bands representing full DvSSJ1 transcript (top arrow) and dsRNA hairpin (bottom arrow). (B) Northern blots of DvSSJ1 siRNA containing events and a non-transgenic control (NTC). Two separate artificial miRNA constructs were designed to express 21-bp DvSSJ1 siRNA-1 (TCCTTGATATCCGGTTCGGTA) and siRNA-2 (TAGTAGCCTTGATATCCGGTT). Exiqon LNA 5′ Biotin-labelled DNA probes (5 ng ml⁻¹) were used for siRNA northern analyses and zm-miR168 was included as an internal control (Supplementary Table 3).