REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Alexa Fluor donkey anti-goat 488	Invitrogen	A11055; RRID: AB_2534102
Alexa Fluor donkey anti-mouse 555	Invitrogen	A31570; RRID: AB_2536180
Alexa Fluor donkey anti-rabbit 647	Invitrogen	A31573; RRID: AB_2536183
Goat anti-GFP	Abcam	ab5450; RRID: AB_304897
Mouse anti-proglucagon	Santa Cruz	sc-514592; RRID: AB_2629431
Rabbit anti-chromogranin A	Santa Cruz	sc-13090; RRID: AB_2080982
Bacterial and Virus Strains
One Shot OmniMAX 2 T1R Chemically Competent E. coli	ThermoFisher Scientific	C854003
Biological Samples
Human ileum	Addenbrooke’s Hospital Human Research Tissue Bank	N/A
Chemicals, Peptides, and Recombinant Proteins
[Leu15]-gastrin I (human)	Sigma-Aldrich	G9145
A-83-01	Tocris	2939
AM-1638 (FFAR1 agonist)	Generon	HY-13467
Amphotericin B	Sigma-Aldrich	A4888
Angiotensin II (AngII)	Sigma-Aldrich	A9525
AR231453 (GPR119 agonist)	Sigma-Aldrich	SML1883
Arginine vasopressin acetate (AVP)	Sigma-Aldrich	V9879
B27 supplement (minus vitamin A)	Invitrogen	12587-010
BTXpress electroporation solution	BTX	45-0805
DAPT	Generon	1855
EGF (murine)	Invitrogen	PMG8043
FGF-2/basic (human)	Peprotech	AF-100-18C
Forskolin	Sigma-Aldrich	F6886
Fura2-AM	Invitrogen	F1221
G418 (geneticin)	Sigma-Aldrich	A1720
GPBAR-A	Sigma-Aldrich	SML1207
IBMX (3-isobutyl-1-methylxanthine)	Sigma-Aldrich	I7018
IGF-1 (human)	Biolegend	711308
N2 supplement	Invitrogen	17502-048
NAC (N-Acetyl-L-Cysteine)	Sigma-Aldrich	A9165
Nicotinamide	Sigma-Aldrich	N0636
Noggin (murine)	Peprotech	250-38
PD0325901	Sigma-Aldrich	PZ0162
Phloridzin dihydrate	Sigma-Aldrich	P3449
Rock Inhibitor Y27632	Tocris	1254
SB202190	Sigma-Aldrich	S7067
Y-27632 dihydrochloride	Tocris	1254
Critical Commercial Assays
Total GLP-1 (ver. 2) Assay	MesoScale Discovery	K150JVC
SMARTer Stranded Total RNA-Seq v2 Pico Input Mammalian Kit	Takara Bio	634413
Oasis HLB μElution Solid Phase Extraction (SPE) Plate	Waters	186008052
Deposited Data
Bulk RNA sequencing data	Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/	GSE148224
Sorted cell peptidomics data	PRIDE repository https://www.ebi.ac.uk/pride/	PXD017825
Experimental Models: Cell Lines
hGLU-Venus ileal organoid line	This manuscript
L-Wnt3A cell line	ATCC	CRL-2647; RRID: CVCL_0635
R-spondin1 cells	Trevigen	3710-001-K
Oligonucleotides
Forward primer to check 5′ integration of Venus insert CTCTTGACGATATTTTGCAGTGT	This paper	N/A
Reverse primer to check 5′ integration of Venus insert ATCAGCTTCAGGGTCAGCTT	This paper	N/A
Forward primer to check 3′ integration of Venus insert TGGCTACCCGTGATATTGCT	This paper	N/A
Reverse primer to check 3′ integration of Venus insert CCCTTTGTCCATAAATCCCTCC	This paper	N/A
Recombinant DNA
pTOPO_hGLU_P2A_Venus_PA_fxPGKNeo_hGLU	This paper	N/A
px458-pSpCas9(BB)-2A-GFP CRISPR-Cas9	Ran et al., 2013	Addgene #48138
Software and Algorithms
BBMap (v38.76)	Bushnell B.	http://sourceforge.net/projects/bbmap/
BD FACSChorus	BD Biosciences	N/A
cutadapt (v2.7)	Martin, 2011	https://cutadapt.readthedocs.io/en/stable/
DESeq2 (v1.24.0)	Love et al., 2014	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
featureCounts (v2.0.0)	Liao et al., 2014	http://subread.sourceforge.net/
Fiji	Schindelin et al., 2012	https://imagej.net/Fiji
Metafluor	Molecular Devices	N/A
pCLAMP (v.7.3)	Molecular Devices	N/A
PEAKS (v8.5)	Bioinformatics Solutions Inc	http://www.bioinfor.com/peaks-studio/
RStudio (v1.2)		https://www.rstudio.com/products/rstudio
Xcalibur (v3.0.63)	ThermoFisher Scientific	https://www.thermofisher.com/order/catalog/product/OPTON-30487
ZEN 3.1 (blue edition)	ZEISS	https://www.zeiss.com/microscopy/int/products/microscope-software/zen.html