Fig. 2.

Generation of IL-1R2^fl/fl and IL-1R2^−/− mice. A Genetic approach to generate IL-1R2^fl/fl mice was designed to induce deletion of exon 3 encoding part of the extracellular binding domain, generating a frameshift from exon 4 to all downstream exons leading to genetic inhibition of IL-1R2. B Genotyping identification of IL-1R2^fl/fl mice was carried out by PCR using the following primers: Forward, TGTCTCCATCAGACTGACTTTAGG, depicted (1), and reverse, ACCATGTCTGCCTGTTCACC, depicted (2) on genomic DNA. Amplification product size obtained was as follows: wild type (228 bp) and IL-1R2^fl/fl (347 bp). C Genotypic identification of exon 3 deletion in IL-1R2^−/− mice (obtained by crossing IL-1R2^fl/fl mice with mice expressing Cre recombinase under a keratin 14 promoter) was carried out by PCR on isolated genomic DNA using the following primers: Forward, GTAGTGGGCAATCAGATGGAC, depicted (3), and reverse, ACCATGTCTGCCTGTTCACC, depicted (2). Amplification product size obtained was 300 bp in the IL-1R2−/− mice after Cre recombination