Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2020 Jul 9;10:11279. doi: 10.1038/s41598-020-67790-0

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© The Author(s) 2020

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

PMC Copyright notice

miR-370-3p regulates HCN4. (a) Predicted miR-370-3p binding site in exon 2 of HCN4. In the mutant, the predicted exon 2 binding site was mutated from AUCAUCCUUGACCCGCAGAGGA (wild-type) to AUCAUCCUUGCAACGCAGAGGA (mutant)—the corresponding nucleotides are in bold. (b) Luciferase reporter gene construct. PGK, phosphoglycerate kinase 1. (c) Luciferase reporter assay showing effect of miR-370-3p on HCN4. Effects mediated by potential binding sites in exons 2 (left) and 8 (right) were investigated. Bars show luciferase activity (surrogate of HCN4) when: miR-370-3p was incubated with the wild-type exon; miR-370-3p was incubated with a mutant exon (potential binding site mutated); and wild-type exon was not exposed to miR-370-3p. Luciferase activity is shown 24 h after co-transfection. Exon 2, n = 14, 10 and 5 measurements; exon 8, n = 7, 6 and 7 measurements. Exon 2: *P < 0.05, Kruskal–Wallis test followed by Dunn’s multiple comparisons test; in addition, the Mann–Whitney test was used to test the difference between miR-370-3p + HCN4 exon 2 and control (HCN4 exon 2 only) and the P value is shown. Exon 8: one-way ANOVA revealed no significant differences.