Figure 7.
miR-370-3p regulates HCN4. (a) Predicted miR-370-3p binding site in exon 2 of HCN4. In the mutant, the predicted exon 2 binding site was mutated from AUCAUCCUUGACCCGCAGAGGA (wild-type) to AUCAUCCUUGCAACGCAGAGGA (mutant)—the corresponding nucleotides are in bold. (b) Luciferase reporter gene construct. PGK, phosphoglycerate kinase 1. (c) Luciferase reporter assay showing effect of miR-370-3p on HCN4. Effects mediated by potential binding sites in exons 2 (left) and 8 (right) were investigated. Bars show luciferase activity (surrogate of HCN4) when: miR-370-3p was incubated with the wild-type exon; miR-370-3p was incubated with a mutant exon (potential binding site mutated); and wild-type exon was not exposed to miR-370-3p. Luciferase activity is shown 24 h after co-transfection. Exon 2, n = 14, 10 and 5 measurements; exon 8, n = 7, 6 and 7 measurements. Exon 2: *P < 0.05, Kruskal–Wallis test followed by Dunn’s multiple comparisons test; in addition, the Mann–Whitney test was used to test the difference between miR-370-3p + HCN4 exon 2 and control (HCN4 exon 2 only) and the P value is shown. Exon 8: one-way ANOVA revealed no significant differences.