Table 2.
Sequence, size, GC content, melting temperature (Tm) and change in free energy of hybridization (ΔG) of the oligonucleotide probes specifically designed to target each bacteria (E. coli, Klebsiella sp., S. aureus, S. uberis, and S. agalactiae) and the negative control. The melting temperature and Gibbs energy were calculated by the nearest-neighbor model.
Target | Size (bp) | GC% | Tm (°C) |
ΔG (kcal/mol) |
|
---|---|---|---|---|---|
E. coli | GAGCAAAGGTATTAACTTTACTCCC | 25 | 40 | 53.5 | −43.90 |
Klebsiella sp. | CACATCCGACTTGACAGA | 18 | 50 | 51.6 | −31.44 |
S. aureus | CACTTTTGAACCATGCGGTTCAAAATATTATCC | 33 | 36.4 | 58.7 | −61.40 |
S. uberis | GAACTATGGTTAAGCCACA | 19 | 42.1 | 49.5 | −33.17 |
S. agalactiae | AACTAACATGTGTTAATCACTCTTATGC | 28 | 32.1 | 53.8 | −44.59 |
Neg. control | GCCTGGCGATACCGCTGTTA | 20 | 60 | 57.1 | − |