Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | anti-CSP (mouse monoclonal) | Yoshida et al., 1980 | MR4: MRA-100 | mAb 3D11 |
| Antibody | anti-TRAP (rabbit ployclonal) | This paper | / | / |
| Antibody | anti-rabbit (Goat) | ThermoFisher Scientific | Cat#A-11034 | coupled to AlexaFluor 488 |
| Antibody | anti-rabbit (Goat) | ThermoFisher Scientific | Cat#A10523 | coupled to Cy5 |
| Antibody | anti-mouse (Goat) | ThermoFisher Scientific | Cat#A-11001 | coupled to AlexaFluor 488 |
| Antibody | anti-mouse (Goat) | ThermoFisher Scientific |
Cat#A10524 | coupled to Cy5 |
| Antibody | anti-rabbit (Goat) | Bio-Rad | Cat#1705046 | Immun Star (GAR)-HRP |
| Antibody | anti-mouse (sheep) | GE-Healthcare | NXA931-1ML | IgG, HRP linked whole Ab |
| Bacteria (Escherichia coli) | XL1-blue cells | Agilent technologies | Cat#200236 | Chemically competent cells |
| Other | Hoechst 33342 | ThermoFisher Scientific | Cat#H3570 | / |
| Commercial assay or kit | SYBR Green PCR Master Mix | ThermoFisher Scientific | Cat#4309155 | / |
| Cell line (Homo sapiens) | HepG2 | ATCC | HB-8065 | / |
| Strain (Mus musculus) | NMRI | Janvier Labs/Charles River Laboratories | / | / |
| Strain (Mus musculus) | C57BL/6JRj | Janvier Labs/Charles River Laboratories | / | / |
| Strain (Plasmodium berghei) | ANKA | Vincke and Bafort, 1968 | MR4: MRA-671 | / |
| Strain (Plasmodium berghei) | trap(-)rec | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | trapΔI | this paper | / | ANKA background |
| Strain (Plasmodium berghei) |
fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | TRAP-I fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | MIC2-I fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | αX-I fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | αL-I fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | TRAP-I non-fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | MIC2-I non-fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | αX-I non-fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | αL-I non-fluo | this paper | / | ANKA background |
| Strain (Plasmodium berghei) | RevCharge non-fluo | this paper | / | ANKA background |
| Sequenced-based reagent | gapdh forward | this paper | PCR primers | TGAGGCCGGTGCTGAGTATGTCG |
| Sequenced-based reagent | gapdh reverse | this paper | PCR primers | CCACAGTCTTCTGGGTGGCAGTG |
| Sequenced-based reagent | 18 s RNA forward | this paper | PCR primers | AAGCATTAAATAAAGCGAATACATCCTTAC |
| Sequenced-based reagent | 18 s RNA reverse | this paper | PCR primers | GGAGATTGGTTTTGACGTTTATGTG |
| Recombinant DNA reagent | TRAP gene sequence: TRAP-I | ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | TRAP gene sequence: MIC2-I | ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | TRAP gene sequence: αX-I |
ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | TRAP gene sequence: αL-I | ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | TRAP gene sequence: RevCharge | ThermoFisher Scientific | / | codon modified (E. coli K12) |
| Recombinant DNA reagent | pMK-RV | ThermoFisher Scientific | / | KanR |
| Recombinant DNA reagent | Pb238 |
Deligianni et al., 2011
Singer et al., 2015 |
/ | AmpR |
| Recombinant DNA reagent |
PbGEM-107890 |
Schwach et al., 2015
PlasmoGEM |
/ | https://plasmogem.sanger.ac.uk/designs/search_result?id=PbGEM-107890 |
| Software, algorithm | Prism 5.0 | GraphPad, San Diego | / | https://www.graphpad.com/scientific-software/prism/ |
| Software, algorithm | PyMOL | The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC | / | https://pymol.org/2/ |
| Software, algorithm | AxioVision | Carl Zeiss Microscopy | / | https://www.zeiss.com/microscopy/int/home.html |
| Software, algorithm | Volocity | PerkinElmer | / | http://www.perkinelmer.de/corporate |
| Software, algorithm | ApE | ApE – A plasmid Editor by M. Wayne Davis | / | http://jorgensen.biology.utah.edu/wayned/ape/ |
| Software, algorithm | ImageJ | Schindelin et al., 2012 | / | https://imagej.nih.gov/ij/ |
| Software, algorithm | Clustal Omega | Sievers et al., 2011 | / | https://www.ebi.ac.uk/Tools/msa/clustalo/ |
| Software, algorithm | Optimizer | Puigbò et al., 2007 | / | http://genomes.urv.es/OPTIMIZER/ |
| Software, algorithm | PlasmoDB (version 26–34) | Aurrecoechea et al., 2009 | / | http://plasmodb.org/plasmo/ |