Skip to main content
. 2020 Jul 10;9:e57572. doi: 10.7554/eLife.57572

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional
information
Antibody anti-CSP (mouse monoclonal) Yoshida et al., 1980 MR4: MRA-100 mAb 3D11
Antibody anti-TRAP (rabbit ployclonal) This paper / /
Antibody anti-rabbit (Goat) ThermoFisher Scientific Cat#A-11034 coupled to AlexaFluor 488
Antibody anti-rabbit (Goat) ThermoFisher Scientific Cat#A10523 coupled to Cy5
Antibody anti-mouse (Goat) ThermoFisher Scientific Cat#A-11001 coupled to AlexaFluor 488
Antibody anti-mouse (Goat) ThermoFisher
Scientific
Cat#A10524 coupled to Cy5
Antibody anti-rabbit (Goat) Bio-Rad Cat#1705046 Immun Star (GAR)-HRP
Antibody anti-mouse (sheep) GE-Healthcare NXA931-1ML IgG, HRP linked whole Ab
Bacteria (Escherichia coli) XL1-blue cells Agilent technologies Cat#200236 Chemically competent cells
Other Hoechst 33342 ThermoFisher Scientific Cat#H3570 /
Commercial assay or kit SYBR Green PCR Master Mix ThermoFisher Scientific Cat#4309155 /
Cell line (Homo sapiens) HepG2 ATCC HB-8065 /
Strain (Mus musculus) NMRI Janvier Labs/Charles River Laboratories / /
Strain (Mus musculus) C57BL/6JRj Janvier Labs/Charles River Laboratories / /
Strain (Plasmodium berghei) ANKA Vincke and Bafort, 1968 MR4: MRA-671 /
Strain (Plasmodium berghei) trap(-)rec this paper / ANKA background
Strain (Plasmodium berghei) trapΔI this paper / ANKA background
Strain
(Plasmodium berghei)
fluo this paper / ANKA background
Strain (Plasmodium berghei) TRAP-I fluo this paper / ANKA background
Strain (Plasmodium berghei) MIC2-I fluo this paper / ANKA background
Strain (Plasmodium berghei) αX-I fluo this paper / ANKA background
Strain (Plasmodium berghei) αL-I fluo this paper / ANKA background
Strain (Plasmodium berghei) TRAP-I non-fluo this paper / ANKA background
Strain (Plasmodium berghei) MIC2-I non-fluo this paper / ANKA background
Strain (Plasmodium berghei) αX-I non-fluo this paper / ANKA background
Strain (Plasmodium berghei) αL-I non-fluo this paper / ANKA background
Strain (Plasmodium berghei) RevCharge non-fluo this paper / ANKA background
Sequenced-based reagent gapdh forward this paper PCR primers TGAGGCCGGTGCTGAGTATGTCG
Sequenced-based reagent gapdh reverse this paper PCR primers CCACAGTCTTCTGGGTGGCAGTG
Sequenced-based reagent 18 s RNA forward this paper PCR primers AAGCATTAAATAAAGCGAATACATCCTTAC
Sequenced-based reagent 18 s RNA reverse this paper PCR primers GGAGATTGGTTTTGACGTTTATGTG
Recombinant DNA reagent TRAP gene sequence: TRAP-I ThermoFisher Scientific / codon modified (E. coli K12)
Recombinant DNA reagent TRAP gene sequence: MIC2-I ThermoFisher Scientific / codon modified (E. coli K12)
Recombinant DNA reagent TRAP gene
sequence: αX-I
ThermoFisher Scientific / codon modified (E. coli K12)
Recombinant DNA reagent TRAP gene sequence: αL-I ThermoFisher Scientific / codon modified (E. coli K12)
Recombinant DNA reagent TRAP gene sequence: RevCharge ThermoFisher Scientific / codon modified (E. coli K12)
Recombinant DNA reagent pMK-RV ThermoFisher Scientific / KanR
Recombinant DNA reagent Pb238 Deligianni et al., 2011
Singer et al., 2015
/ AmpR
Recombinant
DNA reagent
PbGEM-107890 Schwach et al., 2015
PlasmoGEM
/ https://plasmogem.sanger.ac.uk/designs/search_result?id=PbGEM-107890
Software, algorithm Prism 5.0 GraphPad, San Diego / https://www.graphpad.com/scientific-software/prism/
Software, algorithm PyMOL The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC / https://pymol.org/2/
Software, algorithm AxioVision Carl Zeiss Microscopy / https://www.zeiss.com/microscopy/int/home.html
Software, algorithm Volocity PerkinElmer / http://www.perkinelmer.de/corporate
Software, algorithm ApE ApE – A plasmid Editor by M. Wayne Davis / http://jorgensen.biology.utah.edu/wayned/ape/
Software, algorithm ImageJ Schindelin et al., 2012 / https://imagej.nih.gov/ij/
Software, algorithm Clustal Omega Sievers et al., 2011 / https://www.ebi.ac.uk/Tools/msa/clustalo/
Software, algorithm Optimizer Puigbò et al., 2007 / http://genomes.urv.es/OPTIMIZER/
Software, algorithm PlasmoDB (version 26–34) Aurrecoechea et al., 2009 / http://plasmodb.org/plasmo/