KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| rabbit anti-FLAG | Sigma-Aldrich | Cat# F7425; RRID: AB_439687 |
| mouse anti-FLAG | Sigma-Aldrich | Cat# F1804; RRID: AB_262044 |
| mouse anti-Myc | Cell Signaling Technology | Cat# 2276; RRID: AB_331783 |
| rabbit anti-GST | Cell Signaling Technology | Cat# 2625; RRID: AB_490796 |
| mouse anti-E.coli RNA polymerase β | BioLegend | Cat# 663903; RRID: AB_2564524 |
| HRP-conjugated goat anti-Rabbit IgG | Bio-Rad | Cat# 170–6515; RRID: AB_11125142 |
| HRP-conjugated goat anti-mouse IgG | Santa Cruz Biotechnology | Cat# sc-2005; RRID: AB_631736 |
| Bacterial and Virus Strains | ||
| Listeria monocytogenes 10403s | Rauch et al., 2017 | RefSeq: NC_017544.1 |
| Listeria monocytogenes 10403s derivatives | This paper | See Table S2 |
| Listeria ivanovii WSLC 30167 | Hupfeld et al., 2018 | RefSeq: NZ_CP009575.1 |
| Listeria ivanovii WSLC 3009 | Hupfeld et al., 2018 | RefSeq: NZ_CP007172.1 |
| Listeria monocytogenes Mack | Hupfeld et al., 2018 | https://doi.org/10.1093/nar/gky544 |
| Pseudomonas aeruginosa strain PAO1 | Laboratory of Alan Davidson | RefSeq: NC_002516.2 |
| Pseudomonas aeruginosa strain PAO1 derivatives | This paper | N/A |
| Escherichia coli DH5α | New England Biolabs | Cat #C2982I |
| E. coli Rosetta (DE3) pLysS | QB3 Macrolab | N/A |
| Escherichia coli SM10 | Laboratory of Daniel Portnoy | N/A |
| E. coli BB101 | Garcia et al., 2019 | https://doi.org/10.1016/j.celrep.2019.10.017 |
| Listeria phage A006 | This paper | RefSeq: NC_009815.1 |
| Listeria phage A006 derivatives | This paper | See Table S2 |
| Listeria phage A118 | This paper | RefSeq: NC_003216.1 |
| Listeria phage J0161a | Rauch et al., 2017 | RefSeq: NC_017545.1 |
| Listeria phage A511 | Hupfeld et al., 2018 | RefSeq: NC_009811.2 |
| Listeria phages P35 | This paper | RefSeq: NC_009814.1 |
| Pseudomonas phage JBD30 | Laboratory of Alan Davidson | RefSeq: NC_020198.1 |
| Phage Mu | Garcia et al., 2019 | https://doi.org/10.1016/j.celrep.2019.10.017 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| AcrIIA1 protein homologs tested for Cas9 inhibition | This paper | See Table S1 |
| Purified protein: SpyCas9 | QB3 Macrolab | N/A |
| Purified protein: 6xHis-MBP-SpyCas9 | This paper | N/A |
| Purified protein: 6xHis-MBP-deadSpyCas9 | This paper | N/A |
| Purified protein: 6xHis-MBP-SpyCas9(D10A) | This paper | N/A |
| Purified protein: 6xHis-MBP-SpyCas9(H840A) | This paper | N/A |
| Purified protein: 6xHis-AcrIIA1 | This paper | N/A |
| Purified protein: 6xHis-AcrIIA1(T16A) | This paper | N/A |
| Purified protein: 6xHis-AcrIIA1(T114A/F115A) | This paper | N/A |
| Purified protein: 6xHis-AcrIIA1(F115A) | This paper | N/A |
| Purified protein: GST-AcrIIA1 | This paper | N/A |
| Purified protein: GST-AcrIIA2b.3 | This paper | N/A |
| Monolith His-Tag Labeling Kit RED-tris-NTA | Nanotemper Technologies | Cat #MO-L018 |
| Monolith NT Protein Labeling kit RED-NHS | Nanotemper Technologies | Cat # L001 |
| Tetrazolium Violet | TCI Chemicals | Cat #T0174 |
| Critical Commercial Assays | ||
| Gibson Assembly Master Mix | New England Biolabs | Cat #E2611L |
| Phusion Hot Start Flex DNA Polymerase | New England Biolabs | Cat #M0535S |
| TURBO DNA-free Kit | Thermo Fisher Scientific | Cat #AM1907 |
| Luna Universal One-Step RT-qPCR Kit | New England Biolabs | Cat #E3005S |
| Myc-Tag Magnetic Bead Conjugate | Cell Signaling Technology | Cat #5698 |
| Glutathione Magnetic Agarose Beads | Thermo Fisher Scientific | Cat #78601 |
| 4–20% Mini-PROTEAN TGX gels | Bio-Rad | Cat #4561096 |
| Experimental Models: Cell Lines | ||
| Human: HEK 293T cells | ATCC | ATCC CRL-11268 |
| Oligonucleotides | ||
| RT qPCR primer cas9-FWD: ATGCCGCGATAGATGGTTAC | This paper | N/A |
| RT qPCR primer cas9-REV: CGCCTTCGATGTTCTCCAATA | This paper | N/A |
| RT qPCR primer 16s-FWD: CCTGGTAGTCCACGCCGT | This paper | N/A |
| RT qPCR primer 16s-REV: TGCGTTAGCTGCAGCACTAAG | This paper | N/A |
| Target DNA used in SpyCas9-Acr in vitro binding assays CTCAGCCTGGAAGAGATCGTAACGCGAACTACGCGGGTTGGTATACCAACATCATGACCT |
This paper | N/A |
| oligonucleotides used in human cell experiments | This paper | See Table S4 |
| Recombinant DNA | ||
| pKSV7 | Rauch et al., 2017 | addgene.org/26686/ |
| pKSV7-derivative plasmids | This paper | See Table S2 |
| pPL2oexL | Rauch et al., 2017 | https://doi.org/10.1016/j.cell.2016.12.009 |
| pPL2oexL-derivative plasmids | This paper | See Table S2 |
| pLEB579 | Beasley et al., 2004 | https://doi.org/10.1093/ps/83.1.45 |
| pLEB579-derivative plasmids | This paper | See Table S2 |
| pLRSR-crRNA plasmid | Hupfeld et al., 2018 | https://doi.org/10.1093/nar/gky544 |
| pHERD30T | Laboratory of Alan Davidson | GenBank: EU603326.1 |
| pHERD30T-derivative plasmids | This paper | N/A |
| pMMB67HE | ATCC | http://www.snapgene.com/resources/plasmid_files/basic_cloning_vectors/pMMB67HE/ |
| pMMB67HE-derivative plasmids | This paper | N/A |
| 6xHis-MBP-SpyCas9 protein expression plasmid | Laboratory of Jennifer Doudna | N/A |
| 6xHis-MBP-deadSpyCas9 protein expression plasmid | Laboratory of Jennifer Doudna | N/A |
| 6xHis-MBP-SpyCas9(D10A) protein expression plasmid | Laboratory of Jennifer Doudna | N/A |
| 6xHis-MBP-SpyCas9(H840A) protein expression plasmid | Laboratory of Jennifer Doudna | N/A |
| pET28 protein expression plasmid | Laboratory of David Morgan | N/A |
| pET28–6xHis-AcrIIA1 protein expression plasmid | This paper | N/A |
| pET28–6xHis-AcrIIA1(T16A) protein expression plasmid | This paper | N/A |
| pET28–6xHis-AcrIIA1(T114A/F115A) protein expression plasmid | This paper | N/A |
| pET28–6xHis-AcrIIA1(F115A) protein expression plasmid | This paper | N/A |
| pGEX-6P-1-GST-AcrIIA1 protein expression plasmid | This paper | N/A |
| pGEX-6P-1-GST-AcrIIA2b.3 protein expression plasmid | This paper | N/A |
| Type II-A, II-B, II-C Cas9-sgRNA plasmids in E. coli | Garcia et al., 2019 | https://doi.org/10.1016/j.celrep.2019.10.017 |
| Nuclease plasmids used in human cell experiments | This paper | See Table S3 |
| sgRNA plasmids used in human cell experiments | This paper | See Table S3 |
| Acr plasmids used in human cell experiments | This paper | See Table S3 |
| Software and Algorithms | ||
| Prism 6.0 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| Gen 5 | BioTek | https://www.biotek.com/products/software-robotics-software/gen5-microplate-reader-and-imager-software/ |
| Image Lab 5.2.1 | BioRad | http://bio-rad.com/en-cn/product/image-lab-software |
| NanoTemper Analysis Software | NanoTemper Technologies | https://nanotempertech.com/monolith/ |
| CRISPResso2 | Clement et al., 2019 | http://crispresso.pinellolab.partners.org/ |
| Other | ||
| Synergy H1 Microplate Reader | BioTek | https://www.biotek.com/products/detection-hybrid-technology-multi-mode-microplate-readers/synergy-h1-hybrid-multi-mode-reader/ |
| Azure c600 Imager | Azure Biosystems | https://www.azurebiosystems.com/imaging-systems/azure-600/ |
| Monolith NT.115 | NanoTemper Technologies | https://nanotempertech.com/monolith/ |
| CFX Real-Time PCR Detection System | BioRad | https://www.bio-rad.com/en-us/product/cfx-connect-real-time-pcr-detection-system |