Antibodies |
rabbit anti-FLAG |
Sigma-Aldrich |
Cat# F7425; RRID: AB_439687 |
mouse anti-FLAG |
Sigma-Aldrich |
Cat# F1804; RRID: AB_262044 |
HRP-conjugated goat anti-Rabbit IgG |
Bio-Rad |
Cat# 170-6515; RRID: AB_11125142 |
HRP-conjugated goat anti-mouse IgG |
Santa Cruz Biotechnology |
Cat# sc-2005; RRID: AB_631736 |
Bacterial and Virus Strains |
Listeria monocytogenes 10403s |
Rauch et al., 2017 |
RefSeq: NC_017544.1
|
Listeria monocytogenes 10403s derivatives |
This paper |
See Table S2
|
Pseudomonas aeruginosa strain PAO1 |
Laboratory of Alan Davidson |
RefSeq: NC_002516.2
|
Pseudomonas aeruginosa strain PAO1 derivatives |
This paper |
N/A |
Escherichia coli DH5α |
New England Biolabs |
Cat #C2982I |
Escherichia coli SM10 |
Laboratory of Daniel Portnoy |
N/A |
Listeria phage A006 |
This paper |
RefSeq: NC_009815.1
|
Listeria phage A006 derivatives |
This paper |
See Table S2
|
Listeria phage A118 |
This paper |
RefSeq: NC_003216.1
|
Listeria phage A502 |
This paper |
RefSeq: MDRA00000000
|
Listeria phage A620 |
This paper |
N/A |
Listeria phage J0161a |
Rauch et al., 2017 |
RefSeq: NC_017545.1
|
Listeria phage J0161a derivatives |
This paper |
N/A |
Listeria phages P35 |
This paper |
RefSeq: NC_009814.1
|
Pseudomonas phage JBD30 |
Laboratory of Alan Davidson |
RefSeq: NC_020198.1
|
Chemicals, Peptides, and Recombinant Proteins |
AcrIIA1 protein homologs tested for promoter repression |
This paper |
See Table S1
|
Purified protein: AcrIIA1 |
This paper |
N/A |
Monolith His-Tag Labeling Kit RED-tris-NTA |
Nanotemper Technologies |
Cat #MO-L018 |
Tetrazolium Violet |
TCI Chemicals |
Cat #T0174 |
Critical Commercial Assays |
Gibson Assembly Master Mix |
New England Biolabs |
Cat #E2611 L |
Phusion Hot Start Flex DNA Polymerase |
New England Biolabs |
Cat #M0535S |
Oligonucleotides |
Listeria reporter phage lysogen confirmation Primer1: TAATTTGCTTAACTGATACC |
This paper |
N/A |
Listeria reporter phage lysogen confirmation Primer2: TGACTACTACGTATATTCG |
This paper |
N/A |
Wild-type Acr promoter for in vitro binding assay: AACTATTGACTACTACGTATATTCGTAGTATAATGTGAAT |
This paper |
N/A |
Terminal Mutations Acr promoter for in vitro binding assay: AACTATTGACAACTACGTATATTCGTAGTTTAATGTGAAT |
This paper |
N/A |
Six Mutations Acr promoter for in vitro binding assay: AACTATTGACAACAACCTATATTGGTTGTTTAATGTGAAT |
This paper |
N/A |
Recombinant DNA |
AcrIIA1-associated promoter sequences |
Twist Bioscience |
See Table S1
|
pKSV7 |
Rauch et al., 2017 |
addgene.org/26686/ |
pKSV7-derivative plasmids |
This paper |
See Table S2
|
pPL2oexL |
Rauch et al., 2017 |
https://doi.org/10.1016/j.cell.2016.12.009 |
pPL2oexL-derivative plasmids |
This paper |
See Table S2
|
pLEB579 |
Beasley et al., 2004 |
https://doi.org/10.1093/ps/83.1.45 |
pLEB579-derivative plasmids |
This paper |
See Table S2
|
pHERD30T |
Laboratory of Alan Davidson |
GenBank: EU603326.1
|
pHERD30T-derivative plasmids |
This paper |
N/A |
pMMB67HE |
ATCC |
http://www.snapgene.com/resources/plasmid_files/basic_cloning_vectors/pMMB67HE/ |
pMMB67HE-derivative plasmids |
This paper |
N/A |
pET28 protein expression plasmid |
Laboratory of David Morgan |
N/A |
pET28-6xHis-AcrIIA1 protein expression plasmid |
This paper |
N/A |
Software and Algorithms |
Prism 6.0 |
GraphPad |
https://www.graphpad.com/scientific-software/prism/ |
Gen 5 |
BioTek |
https://www.biotek.com/products/software-robotics-software/gen5-microplate-reader-and-imager-software/ |
Image Lab 5.2.1 |
BioRad |
http://bio-rad.com/en-cn/product/image-lab-software |
NanoTemper Analysis Software |
NanoTemper Technologies |
https://nanotempertech.com/monolith/ |
Other |
Synergy H1 Microplate Reader |
BioTek |
https://www.biotek.com/products/detection-hybrid-technology-multi-mode-microplate-readers/synergy-h1-hybrid-multi-mode-reader/ |
Azure c600 Imager |
Azure Biosystems |
https://www.azurebiosystems.com/imaging-systems/azure-600/ |
Monolith NT.115 |
NanoTemper Technologies |
https://nanotempertech.com/monolith/ |