Skip to main content
. 2020 Jul 14;9:e53995. doi: 10.7554/eLife.53995

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (Danio rerio)
prp1 Leighton et al., 2018
PMID:29903907
ZFIN ID: ZDB-GENE-041221-2
 
Gene (Danio rerio)
prp2 Fleisch et al., 2013
PMID:23523635
ZFIN ID: ZDB-GENE-041221-3
Gene (Danio rerio)
adrb2a
This paper ZFIN ID: ZDB-GENE-100414-3
Gene (Danio rerio)
pgrmc1
This paper ZFIN ID: ZDB-GENE-041114-91
Strain background
(Danio rerio)
AB UCL Fish Facility
Strain background
(Danio rerio)
TL UCL Fish Facility
Strain background
(Danio rerio)
ABxTup UCL Fish Facility
Strain (Danio rerio)
prp1 (ua5003/ua5003) mutant Leighton et al., 2018
PMID:29903907
ZFIN ID: ZDB-ALT-181113-1
Strain (Danio rerio)
prp2 (ua5001/5001) mutant Leighton et al., 2018
PMID:29903907
ZFIN ID: ZDB-ALT-130724-2
Strain (Danio rerio)
adrb2a (u511/u511) mutant
This paper Allele will be added to ZFIN upon publication acceptance
Strain (Danio rerio)
pgrmc1 (u512/u512) mutant
This paper Allele will be added to ZFIN upon publication acceptance
Antibody anti-DIG-AP antibody (Sheep) polyclonal Roche Cat # 14608125; RRID:AB_2734716
(1:2000)
Antibody anti-Active Caspase 3
(Rabbit)
BD Biosciences
Cat # 559565; RRID:AB_397274
(1:500)
Antibody p44/42 MAP Kinase (L34F12) Mouse mAb
Cell Signaling
 Cat # 4696; RRID:AB_390780
(1:500)
Antibody Phospho-p44/42 MAPK(Erk1/2)(Thr202/Tyr204) Rabbit mAb
Cell Signaling
Cat # 4370; RRID:AB_2315112
(1:500)
Antibody Alexa Fluor 568 goat anti-mouse, polyclonal
Thermo Fisher Scientific
Cat # A-11031; RRID:AB_144696
(1:200)
Antibody Goat anti-Rabbit IgG Alexa 488, polyclonal
Thermo Fisher Scientific
Cat # A-11034; RRID:AB_2576217
(1:200)
Sequence-based reagent galanin probe Chen et al., 2017
PMID:28648499
Plasmid for galanin ISH riboprobe
Sequence-based reagent c-fos probe Reichert et al., 2019
PMID:31537465
Plasmid for c-fos ISH riboprobe
Sequence-based reagent adrb2a This paper Gene-specific oligomer for CRISPR 5’ATTTAGGTGACACTATAGTTTGGACAGATAAGATCTTGTTTTAGAGCTAGAAATAGCAAG-3’
Sequence-based reagent pgrmc1 This paper Gene-specific oligomer for CRISPR 5’ATTTAGGTGACACTATATGCAGACTATGGCCCGGTTGGTTTTAGAGCTAGAAATAGCAAG-3’
Sequence-based reagent gRNA constant region Thermofisher
Constant oligomer for CRISPR 5’AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT AGCTCTAAAAC-3’
Peptide, recombinant protein Beta-Amyloid (1-42); HFIP treated
JPT Peptide Technologies  Cat# SP-Ab-07_0.5
Peptide, recombinant protein Amyloid β 42-1 reverse human
Sigma Aldrich Cat# SCP0048
Peptide, recombinant protein ß-Amyloid (1-42), HiLyte Fluor 647-labeled Eurogentech LTD Cat# AS-64161
Commercial assay or kit T4 DNA polymerase NEB Cat# M0203S
 
Commercial assay or kit PCR clean-up column kit Qiaquick Cat# 28104
 
Commercial assay or kit Ambion MEGAscript SP6 kit Ambion Cat# AM1330
Chemical compound, drug 2000 kDa dextran-conjugated FITC Sigma Aldrich Cat# 52471
3 mg/ml
Chemical compound, drug Chicago Sky Blue 6B Sigma Aldrich Cat# C8679
3 nM
Chemical compound, drug MPEP Cambridge Biosciences Cat# CAY14536
5 μM
Chemical compound, drug Saracatinib Generon Cat# A2133
300 nM
Chemical compound, drug Pentylenetetrazol (PTZ)
Sigma Aldrich Cat# P6500
10 mM
Chemical compound, drug Camptothecin Sigma Aldrich Cat# 208925
1 uM
Software, algorithm Sleep analysis2 Rihel et al., 2010
PMID:21111222
Software, algorithm Dabest estimation plots Ho et al., 2019
PMID:31217592