Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Danio rerio) |
prp1 |
Leighton et al., 2018
PMID:29903907 |
ZFIN ID: ZDB-GENE-041221-2 |
|
| Gene (Danio rerio) |
prp2 |
Fleisch et al., 2013
PMID:23523635 |
ZFIN ID: ZDB-GENE-041221-3 |
|
| Gene (Danio rerio) |
adrb2a
|
This paper | ZFIN ID: ZDB-GENE-100414-3 |
|
| Gene (Danio rerio) |
pgrmc1
|
This paper | ZFIN ID: ZDB-GENE-041114-91 |
|
| Strain background (Danio rerio) |
AB | UCL Fish Facility | ||
| Strain background (Danio rerio) |
TL | UCL Fish Facility | ||
| Strain background (Danio rerio) |
ABxTup | UCL Fish Facility | ||
| Strain (Danio rerio) |
prp1 (ua5003/ua5003) mutant |
Leighton et al., 2018
PMID:29903907 |
ZFIN ID: ZDB-ALT-181113-1 | |
| Strain (Danio rerio) |
prp2 (ua5001/5001) mutant |
Leighton et al., 2018
PMID:29903907 |
ZFIN ID: ZDB-ALT-130724-2 | |
| Strain (Danio rerio) |
adrb2a (u511/u511) mutant |
This paper | Allele will be added to ZFIN upon publication acceptance | |
| Strain (Danio rerio) |
pgrmc1 (u512/u512) mutant |
This paper | Allele will be added to ZFIN upon publication acceptance | |
| Antibody | anti-DIG-AP antibody (Sheep) polyclonal | Roche | Cat # 14608125; RRID:AB_2734716
|
(1:2000) |
| Antibody | anti-Active Caspase 3 (Rabbit) |
BD Biosciences |
Cat # 559565; RRID:AB_397274
|
(1:500) |
| Antibody | p44/42 MAP Kinase (L34F12) Mouse mAb |
Cell Signaling |
Cat # 4696; RRID:AB_390780
|
(1:500) |
| Antibody | Phospho-p44/42 MAPK(Erk1/2)(Thr202/Tyr204) Rabbit mAb |
Cell Signaling |
Cat # 4370; RRID:AB_2315112
|
(1:500) |
| Antibody | Alexa Fluor 568 goat anti-mouse, polyclonal |
Thermo Fisher Scientific |
Cat # A-11031; RRID:AB_144696
|
(1:200) |
| Antibody | Goat anti-Rabbit IgG Alexa 488, polyclonal |
Thermo Fisher Scientific |
Cat # A-11034; RRID:AB_2576217
|
(1:200) |
| Sequence-based reagent | galanin probe |
Chen et al., 2017
PMID:28648499 |
Plasmid for galanin ISH riboprobe | |
| Sequence-based reagent | c-fos probe |
Reichert et al., 2019
PMID:31537465 |
Plasmid for c-fos ISH riboprobe | |
| Sequence-based reagent | adrb2a | This paper | Gene-specific oligomer for CRISPR | 5’ATTTAGGTGACACTATAGTTTGGACAGATAAGATCTTGTTTTAGAGCTAGAAATAGCAAG-3’ |
| Sequence-based reagent | pgrmc1 | This paper | Gene-specific oligomer for CRISPR | 5’ATTTAGGTGACACTATATGCAGACTATGGCCCGGTTGGTTTTAGAGCTAGAAATAGCAAG-3’ |
| Sequence-based reagent | gRNA constant region | Thermofisher |
Constant oligomer for CRISPR | 5’AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT AGCTCTAAAAC-3’ |
| Peptide, recombinant protein | Beta-Amyloid (1-42); HFIP treated |
JPT Peptide Technologies | Cat# SP-Ab-07_0.5 |
|
| Peptide, recombinant protein | Amyloid β 42-1 reverse human |
Sigma Aldrich | Cat# SCP0048 |
|
| Peptide, recombinant protein | ß-Amyloid (1-42), HiLyte Fluor 647-labeled | Eurogentech LTD | Cat# AS-64161 |
|
| Commercial assay or kit | T4 DNA polymerase | NEB | Cat# M0203S |
|
| Commercial assay or kit | PCR clean-up column kit | Qiaquick | Cat# 28104 |
|
| Commercial assay or kit | Ambion MEGAscript SP6 kit | Ambion | Cat# AM1330 |
|
| Chemical compound, drug | 2000 kDa dextran-conjugated FITC | Sigma Aldrich | Cat# 52471 |
3 mg/ml |
| Chemical compound, drug | Chicago Sky Blue 6B | Sigma Aldrich | Cat# C8679 |
3 nM |
| Chemical compound, drug | MPEP | Cambridge Biosciences | Cat# CAY14536 |
5 μM |
| Chemical compound, drug | Saracatinib | Generon | Cat# A2133 |
300 nM |
| Chemical compound, drug | Pentylenetetrazol (PTZ) |
Sigma Aldrich | Cat# P6500 |
10 mM |
| Chemical compound, drug | Camptothecin | Sigma Aldrich | Cat# 208925 |
1 uM |
| Software, algorithm | Sleep analysis2 |
Rihel et al., 2010
PMID:21111222 |
||
| Software, algorithm | Dabest estimation plots |
Ho et al., 2019
PMID:31217592 |