Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Mouse-specific primers used for qRT-PCR analysis
| Gene ID | Sequence 5′–3′ sense | Sequence 5′–3′ e antisense |
|---|---|---|
| cdh5 | gcccagccctacgaacctaaa | gggtgaagttgctgtcctcgt |
| hif1a | catccatgtgaccatgaggaaa | aatatggcccgtgcagtgaag |
| vegf | ccgcagacgtgtaaatgttcct | ttccggtgagaggtctggttc |
| rplpo | gtgtttgacaacggcagcatt | tctccacagacaatgccagga |
