KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Chicken anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, (1:10,000 for IF) | Thermo Fisher Scientific | Cat# A-21200, RRID:AB_2535786 |
| Chicken anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, (1:10,000 for IF) | Thermo Fisher Scientific | Cat# A-21441, RRID:AB_2535859 |
| Mouse Anti-beta-Actin Monoclonal Antibody, Unconjugated, Clone AC-15 (1:10,000 for WB) | Sigma-Aldrich | Cat# A1978, RRID:AB_476692 |
| Rabbit Anti-Phospho-p53 (Ser15) Antibody (1:1000 for WB) | Cell Signaling Technology | Cat# 9284, RRID:AB_331464 |
| Mouse Anti-DNA-RNA Hybrid [S9.6] Antibody (1:500 for IF) | Kerafast | Cat# ENH001, RRID:AB_2687463 |
| Mouse Anti-Human CD2 Monoclonal Antibody, Clone LT2 (1:10 for Flow) | Miltenyi Biotec | Cat# 130-091-115, RRID:AB_244321 |
| Rabbit Anti-RPA2, (phospho Ser4, Ser8) Polyclonal, Unconjugated antibody (1:500 for IF) | Novus | Cat# NBP1-23017, RRID:AB_1726226 |
| Rabbit Anti-53BP1 Polyclonal Antibody (1:500 for IF) | Bethyl | Cat# A300-272A, RRID:AB_185520 |
| Goat anti-Hamster IgG Secondary Antibody, HRP (1:10,000 for WB) | Thermo Fisher Scientific | Cat# PA1-29626, RRID:AB_10985385 |
| Goat Anti-Rabbit IgG, IRDye® 680LT Conjugated antibody (1:10,000 for WB) | LI-COR Biosciences | Cat# 926-68021, RRID:AB_10706309 |
| Goat Anti-Mouse IgG, IRDye® 800CW Conjugated antibody (1:10,000 for WB) | LI-COR Biosciences | Cat# 926-32210, RRID:AB_621842 |
| Mouse Anti-p53 (1C12) mAb Antibody (1:1000 for WB) | Cell Signaling Technology | Cat# 2524, RRID:AB_331743 |
| Rabbit Anti-phosphorylated Histone H2AX (g-H2AX) Polyclonal Antibody (1:500 for IF) | Trevigen | Cat# 4418-APC-100 |
| Rabbit Anti-KAP1 Polyclonal Antibody, Unconjugated (1:500 for WB) | Abcam | Cat# ab10484, RRID:AB_297223 |
| Rabbit Anti-KAP1 (phospho S824) antibody, (1:500 for WB) | Abcam | Cat# ab70369, RRID:AB_1209417 |
| Mouse Anti-NBS1 Monoclonal Antibody, Unconjugated (1:10,000 for WB) | Novus | Cat# NB100-221, RRID:AB_10001212 |
| Rabbit Anti-RAD50 Polyclonal Antibody, Unconjugated (1:10,000 for WB) | Novus | Cat# NBP2-20054 |
| Armenian Hamster Anti-Mre11 Monoclonal Antibody, Unconjugated (1:500 for WB) | Novus | Cat# NBP2-59677 |
| Mouse Anti-RNaseH1 (H-4) Monoclonal Antibody, Unconjugated (1:1000 for WB) | Santa Cruz Biotechnology | Cat# sc-376326, RRID:AB_10987730 |
| Bacterial and Virus Strains | ||
| Endura DUOs Electrocompetent Cells | Lucigen | 60242-2 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Liberase Blendzyme 2 | Roche | 11988425001 |
| Cultrex 3D-Culture Matrix | Trevigen | 3447-020-01 |
| EpiCult-B Mouse Medium Kit | Stem Cell Technologies | 05610 |
| HuMEC Ready Medium (1X) | GIBCO | 12752010 |
| Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 | GIBCO | 11320082 |
| HEPES (1M) | GIBCO | 15630080 |
| Insulin | Sigma-Aldrich | 407709-50MG |
| Penicillin-Streptomycin (10,000 U/mL) | GIBCO | 15140122 |
| DNase I | Worthington | LS002060 |
| Dispase | Stem Cell Technologies | 07913 |
| Trypsin EDTA | GIBCO | 25200-056 |
| Polyethylenimine, Linear (MW 25,000) | Polysciences | 23966 |
| Bovine Serum Albumin | Fisher Scientific | BP9706-160 |
| Carbenicillin | Fisher Scientific | BP26481 |
| Ampicillin | Fisher Scientific | B1760-25 |
| Talazoparib (BMN-673) | Selleck Chemicals | S7048 |
| KU-55933 (ATM Kinase Inhibitor) | Selleck Chemicals | S1092 |
| VE-821 (ATR Kinase Inhibitor) | Sigma-Aldrich | SML1415 |
| Mechlorethamine hydrochloride (HN2) | Sigma-Aldrich | 122564 |
| Paclitaxel | Sigma-Aldrich | T7402 |
| cis-Diammineplatinum(II) dichloride | Sigma-Aldrich | P4394 |
| Doxorubicin hydrochloride | Sigma-Aldrich | D1515 |
| (S)-(+)-Camptothecin | Sigma-Aldrich | C9911 |
| Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | 107689 |
| Corning® Cell-Tak and Tissue Adhesive | Corning | 354240 |
| Critical Commercial Assays | ||
| PlasmoTest | Invivogen | REP-PT1 |
| RNAeasy Plus Mini Kit | QIAGEN | 74136 |
| Comet Assay Kit | Trevigen | 4250-050-K |
| Q5® Hot Start High-Fidelity 2X Master Mix | New England Biolabs | M0494S |
| NEBuilder® HiFi DNA Assembly Master Mix | New England Biolabs | E2621L |
| EdU-Click 594 | Baseclick | BCK-Edu594 |
| TOPO® TA Cloning® Kit for Sequencing | Invitrogen | 450030 |
| T4 DNA Ligase | New England Biolabs | M0202S |
| Experimental Models: Cell Lines | ||
| HEK293T/17 | ATCC | CRL-11268 |
| LA-7 | ATCC | CRL-2283 |
| Experimental Models: Organisms/Strains | ||
| FVB;129-Rb1tm2Brn/Nci Referred to in this manuscript as “Rb1FL” | Frederick National Laboratory for Cancer Research | 01XC1 |
| FVB.129P2-Trp53tm1Brn/Nci Referred to in this manuscript as “Trp53FL” | Frederick National Laboratory for Cancer Research | 01XC2 |
| C57BL/6N-Gt(ROSA) 26Sortm13(CAG-MYC,-CD2*,)Rsky/J Referred to in this manuscript as “R26MycOE” | The Jackson Laboratory | 020458 |
| B6;129-Gt(ROSA) 26Sortm1(CAG-cas9*,-EGFP)Fezh/J Referred to in this manuscript as “R26Cas9” | The Jackson Laboratory | 024857 |
| Oligonucleotides | ||
| sgControl: CTGATTTGAATAATGATGCC | Generated in this study | N/A |
| sgMre11: TGGAGATCACTACTCGAGGC | Generated in this study | N/A |
| pLV-Cre_LKO1 | Addgene | 12106 |
| LentiCRISPR V2 | Addgene | 52961 |
| psPAX2 | Addgene | 12260 |
| pMD2.G | Addgene | 12259 |
| pEGFP-RNASEH1 | Addgene | 108699 |
| LentiCRISPR-Cre-V2-sgControl-LumiFluor | Generated in this study | N/A |
| LentiCRISPR-Cre-V2-sgMre11-LumiFluor | Generated in this study | N/A |
| Lentiviral_pRRL-EF1a-GpNLuc | Gift from Antonio Amelio, Ph.D. | N/A |
| Lentiviral_pRRL-EF1a-NeuT-LumiFluor | Generated in this study | N/A |
| LentiCRISPR-Cre-V2-sgControl-RNaseH1 | Generated in this study | N/A |
| LentiCRISPR-Cre-V2-sgMre11-RNaseH1 | Generated in this study | N/A |
| Software and Algorithms | ||
| BowTie2 v2.3.4.1 | Langmead and Salzberg, 2012 | https://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.3.4.1 |
| Samtools v1.6.0 | Li et al., 2009 | http://www.htslib.org/download/ |
| BedTools v2.26.0 | Quinlan and Hall, 2010 | https://github.com/arq5x/bedtools2 |
| Python R v3.5 | https://www.python.org/ | N/A |
| Ginkgo | Garvin et al., 2015 | http://qb.cshl.edu/ginkgo/?q= |
| Volur algorithm | Generated in this study | https://github.com/pkMyt1/Volur |
| GNU Gzip v1.5 | N.A. | https://www.gnu.org/software/gzip/ |
| Graphpad Prism v8 | N.A. | https://www.graphpad.com/ |
| Python-Levenshtein Library v0.12.0 | N.A. | https://github.com/ztane/python-Levenshtein |
| Fiji | Schindelin et al., 2012 | https://imagej.net/FijitDownloads |
| SnapGene software v4.3.4 | GSL Biotech | https://www.snapgene.com |
| Open Comet v1.3.1 | Gyori et al., 2014 | http://www.cometbio.org |
| Other | ||
| Mouse Reference Sequence GRCm38 | http://www.Ensembl.org//useast.ensembl.org/?redirectsrc=//www.ensembl.org%2F | http://www.ensembl.org//useast.ensembl.org/Mus_musculus/Info/Index?redirectsrc=//www.ensembl.org%2FMus_musculus%2FInfo%2FIndex |
| Microsatellites, CpG Islands, Simple Repeats, SINE Elements, LINE Elements, LTR | UCSC Genome Browser | https://genome.ucsc.edu/cgi-bin/hgTables |
| Genome annotation tables | http://www.Ensembl.org//useast.ensembl.org/?redirectsrc=//www.ensembl.org%2F | Ensembl v91 |