Skip to main content
. Author manuscript; available in PMC: 2020 Jul 15.
Published in final edited form as: Cell Rep. 2020 Feb 4;30(5):1385–1399.e7. doi: 10.1016/j.celrep.2020.01.020

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies

Chicken anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, (1:10,000 for IF) Thermo Fisher Scientific Cat# A-21200, RRID:AB_2535786
Chicken anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, (1:10,000 for IF) Thermo Fisher Scientific Cat# A-21441, RRID:AB_2535859
Mouse Anti-beta-Actin Monoclonal Antibody, Unconjugated, Clone AC-15 (1:10,000 for WB) Sigma-Aldrich Cat# A1978, RRID:AB_476692
Rabbit Anti-Phospho-p53 (Ser15) Antibody (1:1000 for WB) Cell Signaling Technology Cat# 9284, RRID:AB_331464
Mouse Anti-DNA-RNA Hybrid [S9.6] Antibody (1:500 for IF) Kerafast Cat# ENH001, RRID:AB_2687463
Mouse Anti-Human CD2 Monoclonal Antibody, Clone LT2 (1:10 for Flow) Miltenyi Biotec Cat# 130-091-115, RRID:AB_244321
Rabbit Anti-RPA2, (phospho Ser4, Ser8) Polyclonal, Unconjugated antibody (1:500 for IF) Novus Cat# NBP1-23017, RRID:AB_1726226
Rabbit Anti-53BP1 Polyclonal Antibody (1:500 for IF) Bethyl Cat# A300-272A, RRID:AB_185520
Goat anti-Hamster IgG Secondary Antibody, HRP (1:10,000 for WB) Thermo Fisher Scientific Cat# PA1-29626, RRID:AB_10985385
Goat Anti-Rabbit IgG, IRDye® 680LT Conjugated antibody (1:10,000 for WB) LI-COR Biosciences Cat# 926-68021, RRID:AB_10706309
Goat Anti-Mouse IgG, IRDye® 800CW Conjugated antibody (1:10,000 for WB) LI-COR Biosciences Cat# 926-32210, RRID:AB_621842
Mouse Anti-p53 (1C12) mAb Antibody (1:1000 for WB) Cell Signaling Technology Cat# 2524, RRID:AB_331743
Rabbit Anti-phosphorylated Histone H2AX (g-H2AX) Polyclonal Antibody (1:500 for IF) Trevigen Cat# 4418-APC-100
Rabbit Anti-KAP1 Polyclonal Antibody, Unconjugated (1:500 for WB) Abcam Cat# ab10484, RRID:AB_297223
Rabbit Anti-KAP1 (phospho S824) antibody, (1:500 for WB) Abcam Cat# ab70369, RRID:AB_1209417
Mouse Anti-NBS1 Monoclonal Antibody, Unconjugated (1:10,000 for WB) Novus Cat# NB100-221, RRID:AB_10001212
Rabbit Anti-RAD50 Polyclonal Antibody, Unconjugated (1:10,000 for WB) Novus Cat# NBP2-20054
Armenian Hamster Anti-Mre11 Monoclonal Antibody, Unconjugated (1:500 for WB) Novus Cat# NBP2-59677
Mouse Anti-RNaseH1 (H-4) Monoclonal Antibody, Unconjugated (1:1000 for WB) Santa Cruz Biotechnology Cat# sc-376326, RRID:AB_10987730

Bacterial and Virus Strains

Endura DUOs Electrocompetent Cells Lucigen 60242-2

Chemicals, Peptides, and Recombinant Proteins

Liberase Blendzyme 2 Roche 11988425001
Cultrex 3D-Culture Matrix Trevigen 3447-020-01
EpiCult-B Mouse Medium Kit Stem Cell Technologies 05610
HuMEC Ready Medium (1X) GIBCO 12752010
Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 GIBCO 11320082
HEPES (1M) GIBCO 15630080
Insulin Sigma-Aldrich 407709-50MG
Penicillin-Streptomycin (10,000 U/mL) GIBCO 15140122
DNase I Worthington LS002060
Dispase Stem Cell Technologies 07913
Trypsin EDTA GIBCO 25200-056
Polyethylenimine, Linear (MW 25,000) Polysciences 23966
Bovine Serum Albumin Fisher Scientific BP9706-160
Carbenicillin Fisher Scientific BP26481
Ampicillin Fisher Scientific B1760-25
Talazoparib (BMN-673) Selleck Chemicals S7048
KU-55933 (ATM Kinase Inhibitor) Selleck Chemicals S1092
VE-821 (ATR Kinase Inhibitor) Sigma-Aldrich SML1415
Mechlorethamine hydrochloride (HN2) Sigma-Aldrich 122564
Paclitaxel Sigma-Aldrich T7402
cis-Diammineplatinum(II) dichloride Sigma-Aldrich P4394
Doxorubicin hydrochloride Sigma-Aldrich D1515
(S)-(+)-Camptothecin Sigma-Aldrich C9911
Hexadimethrine bromide (Polybrene) Sigma-Aldrich 107689
Corning® Cell-Tak and Tissue Adhesive Corning 354240

Critical Commercial Assays

PlasmoTest Invivogen REP-PT1
RNAeasy Plus Mini Kit QIAGEN 74136
Comet Assay Kit Trevigen 4250-050-K
Q5® Hot Start High-Fidelity 2X Master Mix New England Biolabs M0494S
NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs E2621L
EdU-Click 594 Baseclick BCK-Edu594
TOPO® TA Cloning® Kit for Sequencing Invitrogen 450030
T4 DNA Ligase New England Biolabs M0202S

Experimental Models: Cell Lines

HEK293T/17 ATCC CRL-11268
LA-7 ATCC CRL-2283

Experimental Models: Organisms/Strains

FVB;129-Rb1tm2Brn/Nci Referred to in this manuscript as “Rb1FL Frederick National Laboratory for Cancer Research 01XC1
FVB.129P2-Trp53tm1Brn/Nci Referred to in this manuscript as “Trp53FL Frederick National Laboratory for Cancer Research 01XC2
C57BL/6N-Gt(ROSA) 26Sortm13(CAG-MYC,-CD2*,)Rsky/J Referred to in this manuscript as “R26MycOE The Jackson Laboratory 020458
B6;129-Gt(ROSA) 26Sortm1(CAG-cas9*,-EGFP)Fezh/J Referred to in this manuscript as “R26Cas9 The Jackson Laboratory 024857

Oligonucleotides

sgControl: CTGATTTGAATAATGATGCC Generated in this study N/A
sgMre11: TGGAGATCACTACTCGAGGC Generated in this study N/A

pLV-Cre_LKO1 Addgene 12106
LentiCRISPR V2 Addgene 52961
psPAX2 Addgene 12260
pMD2.G Addgene 12259
pEGFP-RNASEH1 Addgene 108699
LentiCRISPR-Cre-V2-sgControl-LumiFluor Generated in this study N/A
LentiCRISPR-Cre-V2-sgMre11-LumiFluor Generated in this study N/A
Lentiviral_pRRL-EF1a-GpNLuc Gift from Antonio Amelio, Ph.D. N/A
Lentiviral_pRRL-EF1a-NeuT-LumiFluor Generated in this study N/A
LentiCRISPR-Cre-V2-sgControl-RNaseH1 Generated in this study N/A
LentiCRISPR-Cre-V2-sgMre11-RNaseH1 Generated in this study N/A

Software and Algorithms

BowTie2 v2.3.4.1 Langmead and Salzberg, 2012 https://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.3.4.1
Samtools v1.6.0 Li et al., 2009 http://www.htslib.org/download/
BedTools v2.26.0 Quinlan and Hall, 2010 https://github.com/arq5x/bedtools2
Python R v3.5 https://www.python.org/ N/A
Ginkgo Garvin et al., 2015 http://qb.cshl.edu/ginkgo/?q=
Volur algorithm Generated in this study https://github.com/pkMyt1/Volur
GNU Gzip v1.5 N.A. https://www.gnu.org/software/gzip/
Graphpad Prism v8 N.A. https://www.graphpad.com/
Python-Levenshtein Library v0.12.0 N.A. https://github.com/ztane/python-Levenshtein
Fiji Schindelin et al., 2012 https://imagej.net/FijitDownloads
SnapGene software v4.3.4 GSL Biotech https://www.snapgene.com
Open Comet v1.3.1 Gyori et al., 2014 http://www.cometbio.org

Other

Mouse Reference Sequence GRCm38 http://www.Ensembl.org//useast.ensembl.org/?redirectsrc=//www.ensembl.org%2F http://www.ensembl.org//useast.ensembl.org/Mus_musculus/Info/Index?redirectsrc=//www.ensembl.org%2FMus_musculus%2FInfo%2FIndex
Microsatellites, CpG Islands, Simple Repeats, SINE Elements, LINE Elements, LTR UCSC Genome Browser https://genome.ucsc.edu/cgi-bin/hgTables
Genome annotation tables http://www.Ensembl.org//useast.ensembl.org/?redirectsrc=//www.ensembl.org%2F Ensembl v91