Chicken anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, (1:10,000 for IF) |
Thermo Fisher Scientific |
Cat# A-21200, RRID:AB_2535786 |
Chicken anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, (1:10,000 for IF) |
Thermo Fisher Scientific |
Cat# A-21441, RRID:AB_2535859 |
Mouse Anti-beta-Actin Monoclonal Antibody, Unconjugated, Clone AC-15 (1:10,000 for WB) |
Sigma-Aldrich |
Cat# A1978, RRID:AB_476692 |
Rabbit Anti-Phospho-p53 (Ser15) Antibody (1:1000 for WB) |
Cell Signaling Technology |
Cat# 9284, RRID:AB_331464 |
Mouse Anti-DNA-RNA Hybrid [S9.6] Antibody (1:500 for IF) |
Kerafast |
Cat# ENH001, RRID:AB_2687463 |
Mouse Anti-Human CD2 Monoclonal Antibody, Clone LT2 (1:10 for Flow) |
Miltenyi Biotec |
Cat# 130-091-115, RRID:AB_244321 |
Rabbit Anti-RPA2, (phospho Ser4, Ser8) Polyclonal, Unconjugated antibody (1:500 for IF) |
Novus |
Cat# NBP1-23017, RRID:AB_1726226 |
Rabbit Anti-53BP1 Polyclonal Antibody (1:500 for IF) |
Bethyl |
Cat# A300-272A, RRID:AB_185520 |
Goat anti-Hamster IgG Secondary Antibody, HRP (1:10,000 for WB) |
Thermo Fisher Scientific |
Cat# PA1-29626, RRID:AB_10985385 |
Goat Anti-Rabbit IgG, IRDye® 680LT Conjugated antibody (1:10,000 for WB) |
LI-COR Biosciences |
Cat# 926-68021, RRID:AB_10706309 |
Goat Anti-Mouse IgG, IRDye® 800CW Conjugated antibody (1:10,000 for WB) |
LI-COR Biosciences |
Cat# 926-32210, RRID:AB_621842 |
Mouse Anti-p53 (1C12) mAb Antibody (1:1000 for WB) |
Cell Signaling Technology |
Cat# 2524, RRID:AB_331743 |
Rabbit Anti-phosphorylated Histone H2AX (g-H2AX) Polyclonal Antibody (1:500 for IF) |
Trevigen |
Cat# 4418-APC-100 |
Rabbit Anti-KAP1 Polyclonal Antibody, Unconjugated (1:500 for WB) |
Abcam |
Cat# ab10484, RRID:AB_297223 |
Rabbit Anti-KAP1 (phospho S824) antibody, (1:500 for WB) |
Abcam |
Cat# ab70369, RRID:AB_1209417 |
Mouse Anti-NBS1 Monoclonal Antibody, Unconjugated (1:10,000 for WB) |
Novus |
Cat# NB100-221, RRID:AB_10001212 |
Rabbit Anti-RAD50 Polyclonal Antibody, Unconjugated (1:10,000 for WB) |
Novus |
Cat# NBP2-20054 |
Armenian Hamster Anti-Mre11 Monoclonal Antibody, Unconjugated (1:500 for WB) |
Novus |
Cat# NBP2-59677 |
Mouse Anti-RNaseH1 (H-4) Monoclonal Antibody, Unconjugated (1:1000 for WB) |
Santa Cruz Biotechnology |
Cat# sc-376326, RRID:AB_10987730 |
|
Bacterial and Virus Strains |
|
Endura DUOs Electrocompetent Cells |
Lucigen |
60242-2 |
|
Chemicals, Peptides, and Recombinant Proteins |
|
Liberase Blendzyme 2 |
Roche |
11988425001 |
Cultrex 3D-Culture Matrix |
Trevigen |
3447-020-01 |
EpiCult-B Mouse Medium Kit |
Stem Cell Technologies |
05610 |
HuMEC Ready Medium (1X) |
GIBCO |
12752010 |
Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 |
GIBCO |
11320082 |
HEPES (1M) |
GIBCO |
15630080 |
Insulin |
Sigma-Aldrich |
407709-50MG |
Penicillin-Streptomycin (10,000 U/mL) |
GIBCO |
15140122 |
DNase I |
Worthington |
LS002060 |
Dispase |
Stem Cell Technologies |
07913 |
Trypsin EDTA |
GIBCO |
25200-056 |
Polyethylenimine, Linear (MW 25,000) |
Polysciences |
23966 |
Bovine Serum Albumin |
Fisher Scientific |
BP9706-160 |
Carbenicillin |
Fisher Scientific |
BP26481 |
Ampicillin |
Fisher Scientific |
B1760-25 |
Talazoparib (BMN-673) |
Selleck Chemicals |
S7048 |
KU-55933 (ATM Kinase Inhibitor) |
Selleck Chemicals |
S1092 |
VE-821 (ATR Kinase Inhibitor) |
Sigma-Aldrich |
SML1415 |
Mechlorethamine hydrochloride (HN2) |
Sigma-Aldrich |
122564 |
Paclitaxel |
Sigma-Aldrich |
T7402 |
cis-Diammineplatinum(II) dichloride |
Sigma-Aldrich |
P4394 |
Doxorubicin hydrochloride |
Sigma-Aldrich |
D1515 |
(S)-(+)-Camptothecin |
Sigma-Aldrich |
C9911 |
Hexadimethrine bromide (Polybrene) |
Sigma-Aldrich |
107689 |
Corning® Cell-Tak and Tissue Adhesive |
Corning |
354240 |
|
Critical Commercial Assays |
|
PlasmoTest |
Invivogen |
REP-PT1 |
RNAeasy Plus Mini Kit |
QIAGEN |
74136 |
Comet Assay Kit |
Trevigen |
4250-050-K |
Q5® Hot Start High-Fidelity 2X Master Mix |
New England Biolabs |
M0494S |
NEBuilder® HiFi DNA Assembly Master Mix |
New England Biolabs |
E2621L |
EdU-Click 594 |
Baseclick |
BCK-Edu594 |
TOPO® TA Cloning® Kit for Sequencing |
Invitrogen |
450030 |
T4 DNA Ligase |
New England Biolabs |
M0202S |
|
Experimental Models: Cell Lines |
|
HEK293T/17 |
ATCC |
CRL-11268 |
LA-7 |
ATCC |
CRL-2283 |
|
Experimental Models: Organisms/Strains |
|
FVB;129-Rb1tm2Brn/Nci Referred to in this manuscript as “Rb1FL” |
Frederick National Laboratory for Cancer Research |
01XC1 |
FVB.129P2-Trp53tm1Brn/Nci Referred to in this manuscript as “Trp53FL” |
Frederick National Laboratory for Cancer Research |
01XC2 |
C57BL/6N-Gt(ROSA)
26Sortm13(CAG-MYC,-CD2*,)Rsky/J Referred to in this manuscript as “R26MycOE” |
The Jackson Laboratory |
020458 |
B6;129-Gt(ROSA)
26Sortm1(CAG-cas9*,-EGFP)Fezh/J Referred to in this manuscript as “R26Cas9” |
The Jackson Laboratory |
024857 |
|
Oligonucleotides |
|
sgControl: CTGATTTGAATAATGATGCC |
Generated in this study |
N/A |
sgMre11: TGGAGATCACTACTCGAGGC |
Generated in this study |
N/A |
|
pLV-Cre_LKO1 |
Addgene |
12106 |
LentiCRISPR V2 |
Addgene |
52961 |
psPAX2 |
Addgene |
12260 |
pMD2.G |
Addgene |
12259 |
pEGFP-RNASEH1 |
Addgene |
108699 |
LentiCRISPR-Cre-V2-sgControl-LumiFluor |
Generated in this study |
N/A |
LentiCRISPR-Cre-V2-sgMre11-LumiFluor |
Generated in this study |
N/A |
Lentiviral_pRRL-EF1a-GpNLuc |
Gift from Antonio Amelio, Ph.D. |
N/A |
Lentiviral_pRRL-EF1a-NeuT-LumiFluor |
Generated in this study |
N/A |
LentiCRISPR-Cre-V2-sgControl-RNaseH1 |
Generated in this study |
N/A |
LentiCRISPR-Cre-V2-sgMre11-RNaseH1 |
Generated in this study |
N/A |
|
Software and Algorithms |
|
BowTie2 v2.3.4.1 |
Langmead and Salzberg, 2012 |
https://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.3.4.1 |
Samtools v1.6.0 |
Li et al., 2009 |
http://www.htslib.org/download/ |
BedTools v2.26.0 |
Quinlan and Hall, 2010 |
https://github.com/arq5x/bedtools2 |
Python R v3.5 |
https://www.python.org/ |
N/A |
Ginkgo |
Garvin et al., 2015 |
http://qb.cshl.edu/ginkgo/?q= |
Volur algorithm |
Generated in this study |
https://github.com/pkMyt1/Volur |
GNU Gzip v1.5 |
N.A. |
https://www.gnu.org/software/gzip/ |
Graphpad Prism v8 |
N.A. |
https://www.graphpad.com/ |
Python-Levenshtein Library v0.12.0 |
N.A. |
https://github.com/ztane/python-Levenshtein |
Fiji |
Schindelin et al., 2012 |
https://imagej.net/FijitDownloads |
SnapGene software v4.3.4 |
GSL Biotech |
https://www.snapgene.com |
Open Comet v1.3.1 |
Gyori et al., 2014 |
http://www.cometbio.org |
|
Other |
|
Mouse Reference Sequence GRCm38 |
http://www.Ensembl.org//useast.ensembl.org/?redirectsrc=//www.ensembl.org%2F |
http://www.ensembl.org//useast.ensembl.org/Mus_musculus/Info/Index?redirectsrc=//www.ensembl.org%2FMus_musculus%2FInfo%2FIndex |
Microsatellites, CpG Islands, Simple Repeats, SINE Elements, LINE Elements, LTR |
UCSC Genome Browser |
https://genome.ucsc.edu/cgi-bin/hgTables |
Genome annotation tables |
http://www.Ensembl.org//useast.ensembl.org/?redirectsrc=//www.ensembl.org%2F |
Ensembl v91 |