KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rat monoclonal anti-CD45R/B220 (clone RA3-6B2), PercP/Cy5.5-conjugated | BD Biosciences | Cat#103236, RRID: AB_893354 |
| Rat monoclonal anti-CD45R/B220 (clone RA3-6B2), PE-conjugated | BD Biosciences | Cat#561878, RRID: AB_10893353 |
| Rat monoclonal anti-CD45R/B220 (clone RA3-6B2), Biotin-conjugated | BD Biosciences | Cat#553086; RRID: AB_394616 |
| Mouse monoclonal anti-BCL6, Alexa Fluo 647-conjugated | BD Biosciences | Cat#561525, RRID: AB_10898007 |
| Rat monoclonal anti-IgG1 (clone X56), APC-conjugated | BD Biosciences | Cat#550874, RRID: AB_398470 |
| Rat monoclonal anti-IgM (clone 11/41), APC-conjugated | BD Biosciences | Cat#550676, RRID: AB_398464 |
| Rat monoclonal anti-IgD, VioGreen-conjugated | Miltenyi Biotech | Cat#130-103-005, RRID: AB_2659783 |
| Rat monoclonal anti CD93 (Clone AA4.1), PE-conjugated | BioLegend | Cat#136503, RRID: AB_1967094 |
| Rat monoclonal anti CD23 (Clone B3B4), PE/Cy7-conjugated | BioLegend | Cat#101613, RRID: AB_2103037 |
| Rat monoclonal anti I-A/I-E antibody (Clone M5/114.15.2), APC/Cy7-conjugated | BioLegend | Cat#107628, RRID: AB_2069377 |
| Hamster monoclonal anti-CD95 (clone Jo2), PE/Cy7-conjugated | BD Biosciences | Cat#557653,RRID: AB_396768 |
| Mouse monoclonal anti-CD95 (clone Jo2), PE-conjugated | BD Biosciences | Cat#554258, RRID: AB_395330 |
| Anti-PNA, Biotin-conjugated | Vector Laboratories | Cat#B-1075,RRID: AB_2313597 |
| Anti-PNA, FITC-conjugated | Vector Laboratories | Cat#FL-1071,RRID: AB_2315097 |
| Rat monoclonal anti-CD86 (clone B7-2), APC-conjugated | Thermo Fisher Scientific | Cat#17-0862-82,RRID: AB_469419 |
| Rat monoclonal anti-CD184 (CXCR4), PerCP eFluor 710-conjugated | Thermo Fisher Scientific | Cat#46-9991-80,RRID: AB_10670192 |
| Rat monoclonal anti-CD19 (clone 1D3), FITC-conjugated | BD Biosciences | Cat#553785, RRID: AB_395049 |
| Rat monoclonal anti-CD138 (Syndecan 1) (clone 281-2), PE-conjugated | BioLegend | Cat#142504, RRID: AB_10916119 |
| Annexin V Antibody, FITC-conjugated | BD Biosciences | Cat#556419, RRID: AB_2665412 |
| Mouse monoclonal anti-HLA-DR (Clone L243), Alexa-Fluor 700-conjugated | BioLegend | Cat#307626, RRID: AB_493771 |
| Rabbit polyclonal anti-BCL6 (N3 clone) | Santa Cruz Biotechnology | Cat#sc-858,RRID: AB_2063450 |
| Rabbit monoclonal anti-CD3 (clone SP7) | Lab Vision | Cat#RM-9107-S1, RRID: AB_149924 |
| Rabbit polyclonal anti-H3K27Ac | Diagenode | Cat#C15410196, RRID: AB_2637079 |
| Rabbit polyclonal anti-Histone H3 (acetyl K27ac) antibody | Abcam | Cat#ab4729, RRID: AB_2118291 |
| Rabbit polyclonal Histone H3 (acetyl K18) antibody | Abcam | Cat#ab1191, RRID: AB_298692 |
| Rabbit monoclonal anti-Histone H3 (D1H2) | Abcam | Cat#4499, RRID: AB_10544537 |
| Rabbit polyclonal anti-CREBBP (Clone C-20) | Santa Cruz Biotechnology | Cat#sc-583, RRID: AB_2245237 |
| Rabbit polyclonal anti-CREBBP (Clone A-22) | Santa Cruz Biotechnology | Cat#sc-369, RRID: AB_631006 |
| Rabbit polyclonal anti-Ep300 (Clone C-20) | Santa Cruz Biotechnology | Cat#sc-585, RRID: AB_2231120 |
| Rabbit polyclonal anti-Ep300 (Clone N15) | Santa Cruz Biotechnology | Cat#sc-584, RRID: AB_2293429 |
| Rabbit monoclonal anti-EP300 (D2X6N) | Cell Signaling Technology | Cat#54062, RRID: AB_2799450 |
| Rabbit polyclonal Acetylated-Lysine Antibody, unconjugated | Cell Signaling Technology | Cat#9441, RRID: AB_331805 |
| Mouse monoclonal CRISPR/Cas9 Antibody (Clone 7A9), unconjugated | EpiGentek | Cat#A-9000-010,N/A |
| Rat monoclonal anti-Mouse Ig, HRP-conjugated (TrueBlot) | Rockland | Cat#18-8817-33; RRID: AB_2610851 |
| Donkey anti-Rabbit IgG, HRP-conjugated | GE Healthcare | Cat#NA934;RRID: AB_772206 |
| Goat polyclonal anti-Rabbit IgG (H+L), HRP-conjugated | Thermo Fisher Scientific | Cat#31460, RRID: AB_228341 |
| Mouse monoclonal anti-Rabbit IgG, HRP-conjugated (TrueBlot) | Rockland | Cat#18-8816-33, RRID: AB_2610848 |
| Goat anti-Rabbit IgG, EnVision HRP-conjugated | Agilent | Cat#K4003, RRID: AB_2630375 |
| Rat absorbed, made in horse anti-mouse IgG (H+L), biotinylated | Vector Laboratories | Cat#BA-2001, RRID: AB_2336180 |
| TSA Cyanine 3 System - antibody amplification kit | PerkinElmer | Cat#NEL704A001KT, RRID: AB_2572409 |
| Armenian Hamster Anti-CD40 Monoclonal Antibody, Unconjugated, Clone HM40-3 | BD Biosciences | Cat#553721, RRID: AB_395006 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Doxycyclin | Sigma-Aldrich | D9891-25G |
| CCS1477 | Pegg et al., 2017 | N/A |
| CU329 | WO 2016/044770 PCT/US2015/ | N/A |
| Sheep Red Blood Cells in Alsevere’s | Cocalico Biologicals | Cat#20-1334A |
| NP-KLH (Keyhole Limpet Hemocyanin) | Biosearch Technologies | Cat#N-5060-5 |
| Recombinant mouse IL-4 | R&D Systems | Cat#404-ML-010 |
| TRIzol Reagent | Life Technologies | Cat#15596-018 |
| Dynabeads Protein A | Novex | Cat#10002D |
| Lipopolysaccharides | Sigma-Aldrich | Cat#L2630 |
| Streptavidin, Cy3-conjugated | Molecular Probes | Cat#43-4315 |
| Streptavidin, Alkaline Phosphatase (AP)-conjugated | Vector Laboratories | Cat#SA-5100 |
| 3-Amino-9-ethylcarbazole (AEC), tablets | Sigma-Aldrich | Cat#A6926 |
| NBT/BCIP Stock Solution | Roche | Cat#11681451001 |
| Prolong Gold Anti-Fade Mountant with DAPI | Molecular Probes | Cat#P36935 |
| DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate) | BioLegend | Cat#422801 |
| Proteinase Inhibitor Cocktail | Sigma-Aldrich | Cat#P8340 |
| Quant-iT PicoGreen dsDNA Reagent | Life Technologies | Cat#P11496 |
| Critical Commercial Assays | ||
| Cytofix/Cytoperm buffer | BD Biosciences | Cat#554714 |
| CellTrace Violet cell proliferation kit | Thermo Fisher Scientific | Cat#C34557 |
| Mouse B Cell Isolation kit | Miltenyi Biotec | Cat#130-090-862 |
| CellTiter-Glo Luminescent cell viability assay | Promega | Cat#PR-G7572 |
| Pierce ECL Western Blotting Substrate | Thermo Fisher Scientific | Cat#PI32106 |
| RNeasy Mini Kit | Qiagen | Cat#74104 |
| Nucleospin RNA XS | Macherey-Nagel | Cat#740902.10 |
| Superscript First Strand Synthesis System for RT-PCR | Life Technologies | Cat#11904-018 |
| TruSeq RNA Library Preparation Kit v2 (Illumina) | Illumina | Cat#RS-122-2001 |
| TruChIP High Cell Chromatin Shearing Kit | Covaris | Cat#PN520154 |
| Agencourt AMPure XP beads (Protein A magnetic beads) | Beckman Coulter | Cat#A63881 |
| MiniElute Reaction Cleanup Kit | Qiagen | Cat#28204 |
| KAPA SYBR FAST Universal qPCR Kit | KAPA Biosystems | Cat#KK5503KK4824 |
| Deposited Data | ||
| Raw and analyzed RNA-seq data | This paper | GEO: GSE110669 |
| Raw and analyzed ChIP-seq data | This paper | GEO: GSE132365 |
| Experimental Models: Cell Lines | ||
| Human: SU-DHL-4 | ATCC | Cat#CRL-2957, RRID: CVCL_0539 |
| Human: SU-DHL-5 | DSMZ | Cat#ACC-633,RRID: CVCL_1896 |
| Human: SU-DHL-16 | DSMZ | Cat#ACC-539,RRID: CVCL_1168 |
| Human: U2932 | DSMZ | Cat#ACC-633, RRID: CVCL_1896 |
| Human: WSU-DLCL2 | DSMZ | Cat#ACC-575,RRID: CVCL 1902 |
| Human: HEK293T | ATCC | Cat#CRL-3216,RRID: CVCL_0063 |
| Experimental Models: Organisms/Strains | ||
| Mouse: Crebbpfl/+ | Kang-Decker et al, 2004 | N/A |
| Mouse: Ep300fl/+ | Kasper et al, 2006 | N/A |
| Mouse: Cγ1cre/+ | Casola et al., 2006 | N/A |
| Oligonucleotides | ||
| mEp300_Exon8_F: AGTGAAAATGCTGGTGTGGC | This paper | N/A |
| mEp300_Exon11_R: TAGACGGGTCAGGTACAGGA | This paper | N/A |
| sgEP300_E9:CCGGCGTAGGAAATATGGCT | This paper | N/A |
| sgEP300_E17:GGGTCCACAGGTTGACGAAA | This paper | N/A |
| sgEP300_E24:TCATGCTTCTGACAAAACCG | This paper | N/A |
| sgCREBBP_E13:TGTGCACCCATCATGTTCGG | This paper | N/A |
| sgCREBBP_E20:CAGACGTAAGTACCGTCCTG | This paper | N/A |
| sgPPP1R12C_4 (also called Neutral-4):CCAGCGAG TGAAGACGGCAT | This paper | N/A |
| sgPPP1R12C_5 (also called Neutral-5):AGGGAGAC ATCCGTCGGAGA | This paper | N/A |
| Recombinant DNA | ||
| pCW-Cas9 | Wang et al., 2014 | addgene: 50661; RRID: Addgene_50661 |
| pLKO5-sgRNA-EFS-GFP | Heckl et al., 2014 | addgene: 57822; RRID: Addgene_57822 |
| pLKO5-sgRNA-EFS-tRFP | Heckl et al., 2014 | addgene: 57823; RRID: Addgene_57823 |
| pCMV-VSVg | Stuart et al., 2003 | addgene: 8454; RRID: Addgene_8454 |
| pCMV-Δ8.91 | Dr. J. Luban (University of Massachusetts Medical School) |
N/A |
| pLKO5-sgEP300-E9-EFS-GFP | This paper | N/A |
| pLKO5-sgEP300-E9-EFS-tRFP | This paper | N/A |
| pLKO5-sgEP300-E17-EFS-GFP | This paper | N/A |
| pLKO5-sgEP300-E17-EFS-tRFP | This paper | N/A |
| pLKO5-sgEP300-E24-EFS-GFP | This paper | N/A |
| pLKO5-sgEP300-E24-EFS-tRFP | This paper | N/A |
| pLKO5-sgPPP1R12C_4-EFS-GFP | This paper | N/A |
| pLKO5-sgPPP1R12C_4-EFS-tRFP | This paper | N/A |
| pLKO5-sgPPP1R12C_5-EFS-GFP | This paper | N/A |
| pLKO5-sgPPP1R12C_5-EFS-tRFP | This paper | N/A |
| pLKO5-sgCREBBP_E13-EFS-tRFP | This paper | N/A |
| pLKO5-sgCREBBP_E20-EFS-tRFP | This paper | N/A |
| Softwares and Algorithms | ||
| FlowJo (v.10.4.0) | TreeStar | https://www.flowjo.com |
| IMGT/HighV-Quest | Lefranc et al., 2011 | http://www.imgt.org |
| GraphPad Prism (v.6.0) | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| ImageJ | Schindelin et al., 2015 | http://imagej.nih.gov/ij/ |
| NIS Elements software | Nikon | https://www.nikoninstruments.com/Products/Software |
| Bowtie2 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| ChIPseeqer (v2.0) | Giannopoulou and Elemento, 2011 | http://physiology.med.cornell.edu/faculty/elemento/lab/chipseq.shtml |
| ROSE | Loven et al, 2013 | https://bitbucket.org/young_computation/rose |
| SAMtools (v0.1.19) | Li and Durbin, 2009 | http://samtools.sourceforge.net/ |
| FeatureCounts | Liao et al., 2014 | http://bioinf.wehi.edu.au/featureCounts/ |
| DEseq2 | Love et al., 2014 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| Hisat2 | Pertea et al. 2016 | https://ccb.jhu.edu/software/hisat2/index.shtml |
| TIDE | Brinkman et al., 2014 | https://tide.deskgen.com/ |
| CRISP-ID | Dehairs et al., 2016 | http://crispid.gbiomed.kuleuven.be/ |
| Hisat2 | Pertea et al. 2016 | https://ccb.jhu.edu/software/hisat2/index.shtml |
| GSEA (v2.2.0) | Subramanian et al., 2005 | https://software.broadinstitute.org/gsea/index.jsp |
| NCBI Homologene database (2016) | NCBI | ftp://ftp.ncbi.nih.gov/pub/HomoloGene/ |
| NCBI Gene database (2016) | NCBI | ftp://ftp.ncbi.nih.gov/gene/ |
| DAVID (v6.7) | DAVID | https://david.ncifcrf.gov/ |
| Adobe Photoshop (v10.0) | Adobe | Adobe Photoshop, RRID: SCR_014199 |
| VENNY 2.1 | Oliveros, JC (2007-2015) | http://bioinfogp.cnb.csic.es/tools/venny/index.html |
| MSigDB v6.2 | MSigDB | http://software.broadinstitute.org/gsea/msigdb/annotate.jsp |
| Extended GSEA | Lim et al., 2009 | https://github.com/antonybholmes/libgsea |