REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Hamsters anti-CD3e (clone 500A2)	BD Biosciences	Cat#: 560771; RRID:AB_1937314
Rat anti-CD4 (clone RM4-5)	Biolegend	Cat#: 100528; RRID:AB_312729
Mouse anti-CD90.1 (clone OX-7)	Biolegend	Cat#: 202506 RRID:AB_492882
Rat anti-CD90.2 (clone 30-H12)	Biolegend	Cat#: 105308; RRID:AB_313179
Rat anti-IL-17A (clone TC11-18H10.1)	Biolegend	Cat#: 506926; RRID:AB_2632611
Mouse anti-IL-17F (clone 9D3.1C8)	Biolegend	Cat#: 517006; RRID:AB_10661903
Rat anti-GM-CSF (clone MP1-22E9)	Biolegend	Cat#: 505406; RRID:AB_315382
Anti-IL-22 (clone 3F11.3)	Genentech	N/A
Goat anti-IL-24 (polyclonal)	R&D systems	Cat#: AF2786; RRID:AB_2124803
Rat anti-IL-17RA/IL-17R (clone 657603)	R&D systems	Cat#: FAB4482G; RRID:AB_10891099
Goat anti-IL-17RC (polyclonal)	R&D systems	Cat#: FAB2270A; RRID:AB_2125672
Rat anti-IFN-γ (clone XMG1.2)	eBioscience	Cat#: 25-7311-82; RRID:AB_469680
Mouse anti-CD3 (clone SK7)	BD Biosciences	Cat#: 563219; RRID:AB_2738076
Mouse anti-CD4 (clone RPA-T4)	BD Biosciences	Cat#: 562424; RRID:AB_11154417
Mouse anti-IL-17A (clone BL168)	Biolegend	Cat#: 512304; RRID:AB_961390
Mouse anti-IL-17F (clone 033-782)	BD Biosciences	Cat#: 561197; RRID:AB_10611873
Rat anti-GM-CSF (clone BVD2-21C11)	BD Biosciences	Cat#: 562257; RRID:AB_11152076
Rabbit anti-phospho-NF-κB p65 (clone 93H1)	Cell Signaling Technology	Cat#: 4887; RRID:AB_561198
Rabbit anti-phospho-Erk1/2 (clone 197G2)	Cell Signaling Technology	Cat#: 14095; RRID:AB_2728834
Mouse anti-phospho-p38 MAPK (clone 28B10)	Cell Signaling Technology	Cat#: 4551; RRID:AB_331302
Mouse anti-NF-κB p65 (clone F-6)	Santa Cruz Biotechnology	Cat#: sc-8008; RRID:AB_628017
Rat anti-CD4 (clone RM4-4)	eBioscience	Cat#: 11-0043-82; RRID:AB_464900
Rabbit anti-Histone H3 (polyclonal)	EMD Millipore Corporation	Cat#: 06-755; RRID:AB_2118461
Rabbit anti-GAPDH (clone 14C10)	Cell Signaling Technology	Cat#: 2118S; RRID:AB_561053
Mouse anti-IL-17A (clone 17F3)	BioXcell	Cat#: BE0173; RRID:AB_10950102
Mouse anti-IgG1 (clone MOPC1-21)	BioXcell	Cat#: BE0083; RRID:AB_1107784
Rat anti-IL-4 (clone 30340)	R&D systems	Cat#: MAB404; RRID:AB_2128960
Hamster anti-IFN-γ (clone H22)	R&D systems	Cat#: MAB4851; RRID:AB_2123046
Mouse anti-IL-4 (clone 34019)	R&D systems	Cat#: MAB204; RRID:AB_2126745
Mouse anti-IFN-g (clone K3.53)	R&D systems	Cat#: MAB2852; RRID:AB_2123304
Bacterial and Virus Strains
M. tuberculosis H37 Ra	BD	231141
Chemicals, Peptides, and Recombinant Proteins
Complete Freund’s Adjuvant	Sigma	F5881
Bordetella pertussis toxin	Sigma	P7208-50UG
Recombinant mouse TGF-beta 1	R&D systems	Cat#: 7666-MB
Recombinant mouse IL-6	R&D systems	Cat#: 406-ML
Recombinant mouse IL-24	R&D systems	Cat#: 7807-ML
Recombinant mouse IL-23	R&D systems	Cat#: 1887-ML
Recombinant human TGF-beta 1	R&D systems	Cat#: 240-B
Recombinant human IL-1beta	R&D systems	Cat#: 201-LB
Recombinant human IL-6	R&D systems	Cat#: 206-1L
Recombinant human IL-24	R&D systems	Cat#: 1965-1L
Recombinant human IL-23	R&D systems	Cat#: 1290-1L
Recombinant human TGF-beta 1	Peprotech	Cat#: 100-21
Recombinant human IL-1beta	Peprotech	Cat#: 200-01B
Recombinant human IL-6	Peprotech	Cat#: 200-06
Recombinant human IL-23	Peprotech	Cat#: 200-23
MOG35-55	Bio Basic, Inc	Custom synthesis
IRBP161-180	Bio Basic, Inc	Custom synthesis
IRBP1-20	Bio Basic, Inc	Custom synthesis
Critical Commercial Assays
TruSeq RNA Sample Prep Kit	Illumina	FC-122-1001
Deposited Data
Raw and analyzed data	This paper	GEO: GSE152534
Experimental Models: Organisms/Strains
Mouse: R161H. B10.RIII	Horai et al., 2013	N/A
Mouse: Il17A−/−, B6	Nakae et al., 2002	N/A
Mouse: Il17F−/−, B6	Ishigame et al., 2009	N/A
Mouse: Il24−/−, B6	Chan et al., 2006	N/A
Oligonucleotides
Primer for IL-24 promoter Fwd 5′TAGCTAGCTAGCTTTAGCTTCTGGGCT 3′	This paper	N/A
Primer for IL-24 promoter Rev 5′ ATAAGCTTTCAAGGCAGCAGCCTAACA 3′	This paper	N/A
Accell siRNA for IL-24	Dharmacon	N/A
Accell siRNA for Socs1	Dharmacon	N/A
Accell siRNA for Socs3	Dharmacon	N/A
Software and Algorithms
Bowtie2 v2.1.0	Langmead et al., 2009	https://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.1.0/
TopHat2 v2.0.9	Trapnell et al., 2009	https://ccb.jhu.edu/software/tophat/index.shtml
Integrative Genomics Viewer	Robinson et al., 2011	http://software.broadinstitute.org/software/igv/
SAMtools v0.1.19	Robinson et al., 2011	https://sourceforge.net/projects/samtools/files/samtools/0.1.19/
FastQC v0.10.1	Andrews S: FastQC: A quality control tool for high throughput sequence data	https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
eXpress v1.3.1	Roberts et.al., 2013	https://pachterlab.github.io/eXpress/
EdgeR	Robinson et al., 2010	http://bioconductor.org/packages/release/bioc/html/edgeR.html
Genome Analyzer IIx (SCS v2.10 software)	Illumina	https://www.illumina.com/content/dam/illumina-marketing/documents/products/specifications/specification_genome_analyzer.pdf
Flowjo v10	FlowJo	N/A
Prism 7	Graphpad	N/A
Genomatix software	GGA suite	N/A