KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-PAX3 | DSHB | Cat#: Pax3; RRID: AB_528426 |
| Anti-PAX7 | DSHB | Cat#: PAX7; RRID: AB_528428 |
| Anti-MyHC | DSHB | Cat#: MF 20; RRID: AB_2147781 |
| Anti-MET | Cell Signaling Technology | Cat# 8198; RRID: AB_10858224 |
| Anti-CD325 (CDH2) | BD Biosciences | Cat#: 561553; RRID: AB_10713831 |
| Anti-NANOG | Cell Signaling Technology | Cat# 3580; RRID: AB_2150399 |
| Anti-OCT-4A | Cell Signaling Technology | Cat# 2840; RRID: AB_2167691 |
| Anti-SOX2 | Cell Signaling Technology | Cat# 3579; RRID: AB_2195767 |
| Anti-PDGF Receptor alpha (PDGFRA) | Cell Signaling Technology | Cat# 3174; RRID: AB_2162345 |
| Anti-M-Cadherin/Cadherin-15 (CDH15) | R&D Systems | Cat#: AF4096; RRID: AB_10641849 |
| Anti-HGFR/c-MET (MET) - APC | R&D Systems | Cat#: FAB3582A; RRID: AB_1151927 |
| Anti-CD325 (CDH2) - PE | BD Biosciences | Cat#: 561554; RRID: AB_10714646 |
| Anti-CD31 - FITC | Thermo Fisher Scientific | Cat#: 11–0319-42; RRID: AB_2043835 |
| Anti-CD31 - PE | Thermo Fisher Scientific | Cat#: 12–0319-42; RRID: AB_10669160 |
| Anti-CD31 - APC/Cy7 | BioLegend | Cat#: 303120; RRID: AB_10640734 |
| Anti-CD45 - FITC | Thermo Fisher Scientific | Cat#: 11–0459-42; RRID: AB_10852703 |
| Anti-CD45 - PE | Thermo Fisher Scientific | Cat#: 12–0459-42; RRID: AB_1724079 |
| Anti-CD45 - APC/Cy7 | BioLegend | Cat#: 368516; RRID: AB_2566376 |
| Anti-CD235a - FITC | Thermo Fisher Scientific | Cat#: 11–9987-82; RRID: AB_465477 |
| Anti-CD235a - PE | Thermo Fisher Scientific | Cat#: 12–9987-82; RRID: AB_466300 |
| Anti- CD235a - APC/Cy7 | BioLegend | Cat#: 349116; RRID: AB_ 2650978 |
| Anti-ERBB3 - PE | BioLegend | Cat#: 324706; RRID: AB_2099569 |
| Anti-CD271 (NGFR) - PerCP/Cy5.5 | BioLegend | Cat#: 345111; RRID: AB_11204078 |
| Anti-CD57 (HNK-1) - PE/Cy7 | BioLegend | Cat#: 359624; RRID: AB_2632689 |
| Anti-CD140a (PDGFRA) - PE | BD Biosciences | Cat#: 556002; RRID: AB_396286 |
| Anti-CD140a (PDGFRA) - BV786 | BD Biosciences | Cat#: 742669; RRID: AB_2740957 |
| Anti-Rabbit IgG - Alexa Fluor Plus 488 | Thermo Fisher Scientific | Cat#: A32731; RRID: AB_2633280 |
| Anti-Mouse IgG2b - Alexa Fluor 568 | Thermo Fisher Scientific | Cat#: A21144; RRID: AB_ 2535780 |
| Anti-Sheep IgG - PerCP | Thermo Fisher Scientific | Cat#: A32731; RRID: AB_2633280 |
| Anti-Mouse IgG1 - HRP | Thermo Fisher Scientific | Cat#: A10551; RRID: AB_2534048 |
| Anti-Mouse IgG2a - HRP | Thermo Fisher Scientific | Cat#: A10685; RRID: AB_2534065 |
| Anti-Mouse IgG2b - HRP | Thermo Fisher Scientific | Cat#: M32507; RRID: AB_2536649 |
| Anti-Rabbit IgG - HRP | Promega | Cat#: W4011; RRID: AB_430833 |
| Anti-Sheep IgG - PerCP | R&D Systems | Cat#: F0128; RRID: AB_10892337 |
| Anti-Sheep IgG - NL557 | R&D Systems | Cat#: NL010; RRID: AB_884220 |
| Bacterial and Virus Strains | ||
| Biological Samples | ||
| Human embryos, fetuses and juvenile and adult skeletal muscle tissues | Table S1 | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Y-27632 | Tocris | Cat#: 1254; CAS#: 129830–38-2 |
| CHIR99021 | Tocris | Cat#: 4423; CAS#: 252917–06-9 |
| LDN193189 | Tocris | Cat#: 6053; CAS#: 1435934–00-1 |
| SB431542 | Tocris | Cat#: 1614; CAS#: 301836–41-9 |
| FGF2 | Proteintech | Cat#: HZ-1285 |
| HGF | PeproTech | Cat#: 100–39H |
| IGF1 | Sigma-Aldrich | Cat#: I1271 |
| mTeSR1 | StemCell Technologies | Cat#: 85850 |
| DMEM/F-12, HEPES medium | Thermo Fisher Scientific | Cat#: 11330032 |
| DMEM, high glucose medium | Thermo Fisher Scientific | Cat#: 11965092 |
| E6 medium | Thermo Fisher Scientific | Cat#: A4238501 |
| StemPro-34 medium | Thermo Fisher Scientific | Cat#: 10639011 |
| SkGM-2 Skeletal Muscle Cell Growth Medium-2 BulletKit | Lonza | Cat#: CC-3245 |
| StemPro Osteogenesis Differentiation Kit | Thermo Fisher Scientific | Cat#: A1007201 |
| ITS -G supplement | Thermo Fisher Scientific | Cat#: 41400045 |
| N2 supplement | Thermo Fisher Scientific | Cat#: 17502048 |
| Fetal bovine serum (FBS) | Thermo Fisher Scientific | Cat#: 16000044 |
| Knockout Serum Replacement (KSR) | Thermo Fisher Scientific | Cat#: 10828028 |
| GlutaMAX Supplement | Thermo Fisher Scientific | Cat#: 35050061 |
| Nonessential amino acids (NEAA) | Thermo Fisher Scientific | Cat#: 11140076 |
| Sodium Pyruvate | Thermo Fisher Scientific | Cat#: 11360070 |
| 2-Mercaptoethanol | Thermo Fisher Scientific | Cat#: 21985023; CAS#: 60–24-2 |
| 1-Thioglycerol | Sigma-Aldrich | Cat#: M6145; CAS#: 96–27-5 |
| Matrigel hESC-Qualified | Corning | Cat#: 354277 |
| TrypLE Express | Thermo Fisher Scientific | Cat#: 12605010 |
| Collagenase, Type 2 (Collagenase II) | Worthington-Biochem | Cat#: LS004177 |
| Collagenase IV | Thermo Fisher Scientific | Cat#: 17104019 |
| Dispase II | Thermo Fisher Scientific | Cat#: 17105041 |
| DNase I | Sigma-Aldrich | Cat#: D4513 |
| Critical Commercial Assays | ||
| PDMS chip - 26 Drop-seq generators on glass slide | FlowJEM | N/A |
| Barcoded beads for Drop-seq | ChemGenes | Cat#: MACOSKO-2011–1-0(V+) |
| Human TruStain FcX (Fc Receptor Blocking Solution) | BioLegend | Cat#: 422302 |
| Alizarin S, 2% Solution, pH 4.2 | Electron Microscopy Sciences | Cat#: 26206–01 |
| TSA Plus Fluorescein | PerkinElmer | Cat#: NEL741001KT |
| TSA Plus TMR | PerkinElmer | Cat#: NEL742001KT |
| TSA Plus Cyanine 5 | PerkinElmer | Cat#: NEL745001KT |
| RNAscope Multiplex Fluorescent Reagent Kit v2 | Advanced Cell Diagnostics | Cat#: 323100 |
| RNAscope 3-plex negative control probes | Advanced Cell Diagnostics | Cat#: 320871 |
| RNAscope Probe - Hs-NFIX | Advanced Cell Diagnostics | Cat#: 522341 |
| RNAscope Probe - Hs-KLF9-C2 | Advanced Cell Diagnostics | Cat#: 582551-C2 |
| RNAscope Probe - Hs-NFIC | Advanced Cell Diagnostics | Cat#: N/A; custom ordered new probe |
| RNAscope Probe - Hs-CEBPD | Advanced Cell Diagnostics | Cat#: N/A; custom ordered new probe |
| RNeasy Plus Mini Kit | QIAGEN | Cat#: 74134 |
| RNeasy Plus Micro Kit | QIAGEN | Cat#: 74034 |
| iScript Reverse Transcription Supermix for RT-qPCR | Bio-Rad | Cat#: 1708841 |
| SsoAdvanced Universal SYBR Green Supermix | Bio-Rad | Cat#: 1725274 |
| Gibson Assembly Cloning Kit | New England BioLabs | Cat#: E5510S |
| NEBuilder HiFi DNA Assembly Master Mix | New England BioLabs | Cat#: E2621S |
| P3 Primary Cell 4D-Nucleofector X Kit L | Lonza | Cat#: V4XP-3024 |
| ViaFect Transfection Reagent | Promega | Cat#: E4981 |
| Deposited Data | ||
| Raw sequencing reads and processed DGE matrices | This paper | NCBI GEO accession#: GSE147457 |
| Interactive scRNA-seq exploration tools | This paper | skeletal-muscle.cells.ucsc.edu or aprilpylelab.com/datasets |
| Experimental Models: Cell Lines | ||
| Human: H9 (WA09) hESC line | WiCell | RRID: CVCL_9773 |
| Human: PAX7-GFP reporter lines derived from H9 cells | This Paper | N/A |
| Experimental Models: Organisms/Strains | ||
| Oligonucleotides | ||
| Forward sequence for cloning gRNA for homologous recombination of reporter cassette to the PAX7 locus: GTGAGTGGGTGTACGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC | This paper | N/A |
| Reverse sequence for cloning gRNA for homologous recombination of reporter cassette to the PAX7 locus: CACGTACACCCACTCACGGTGTTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAA | This paper | N/A |
| Forward sequence for cloning gRNA targeting PAX7 promoter region for gene activation (Pax7C3): GTCAAACGCGTCCAGAAGCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC | This paper | N/A |
| Reverse sequence for cloning gRNA targeting PAX7 promoter region for gene activation (Pax7C3): AGCTTCTGGACGCGTTTGACGGTGTTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAA | This paper | N/A |
| Forward sequence for cloning gRNA targeting PAX7 promoter region for gene activation (Pax7C4): GGGGCCAAAGTTTCCGAGCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC | This paper | N/A |
| Reverse sequence for cloning gRNA targeting PAX7 promoter region for gene activation (Pax7C4): GGCTCGGAAACTTTGGCCCCGGTGTTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAA | This paper | N/A |
| Forward sequence for cloning gRNA targeting PAX7 promoter region for gene activation (Pax7C5): GGGTCCGGAGAAAGAAGGCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC | This paper | N/A |
| Reverse sequence for cloning gRNA targeting PAX7 promoter region for gene activation (Pax7C5): CGCCTTCTTTCTCCGGACCCGGTGTTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAA | This paper | N/A |
| Forward sequence for cloning gRNA targeting PAX7 promoter region for gene activation (Pax7C6): GCCCCGGCTCGACCTCGTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC | This paper | N/A |
| Reverse sequence for cloning gRNA targeting PAX7 promoter region for gene activation (Pax7C6): AAACGAGGTCGAGCCGGGGCGGTGTTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAA | This paper | N/A |
| Primer pairs for qRT-PCR |
Xi et al., 2017 Methods S1 |
N/A |
| Recombinant DNA | ||
| gRNA_Cloning Vector | Mali et al., 2013 | RRID: Addgene_41824 |
| hCas9 | Mali et al., 2013 | RRID: Addgene_41815 |
| Oct4-IRES-eGFP-PGK-Neo | Yang et al., 2013 | RRID: Addgene_48681 |
| SP-dCas9-VPR | Chavez et al., 2015 | RRID: Addgene_63798 |
| Software and Algorithms | ||
| Drop-seq_tools-1.13 | Macosko et al., 2015 | https://github.com/broadinstitute/Drop-seq/releases/tag/v1.13 |
| Bowtie2 v2.2.9 | Langmead et al., 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Bedtools v2.26.0 | Quinlan and Hall, 2010 | https://github.com/arq5x/bedtools2 |
| Seurat v2.3.3 | Butler et al., 2018 | https://github.com/satijalab/seurat/releases/tag/v2.3.3 |
| Monocle3 | Cao et al., 2019 | https://cole-trapnell-lab.github.io/monocle3/monocle3_docs/ |
| Pheatmap v1.0.12 | The Comprehensive R Archive Network | https://CRAN.R-project.org/package=pheatmap |
| Eulerr v6.0.0 | The Comprehensive R Archive Network | https://CRAN.R-project.org/package=eulerr |
| Metascape | Zhou et al., 2019 | http://metascape.org/gp/index.html#/main/step1 |
| GSEA | Subramanian et al., 2005 | http://software.broadinstitute.org/gsea/index.jsp |
| Gene network analysis | This paper | In STAR Methods; Will be provided upon request |
| Fiji/ImageJ | Schindelin et al., 2012 | http://fiji.sc/ |
| ZEN 3.1 (blue edition) and ZEN 2.6 Pro (blue edition) | ZEISS | https://www.zeiss.com/microscopy/int/products/microscope-software/zen.html |
| PrimerBank | Spandidos et al., 2010 | https://pga.mgh.harvard.edu/primerbank/ |
| Primer-BLAST | Ye et al., 2012 | https://www.ncbi.nlm.nih.gov/tools/primer-blast/ |
| FlowJo | FlowJo, LLC | https://www.flowjo.com/ |
| Other | ||