KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| APC-cy7 anti-mouse B220 antibody | Biolegend | RRID: AB_313007 |
| PE anti-mouse B220 antibody | Biolegend | RRID: AB_312993 |
| Biotin anti-mouse B220 antibody | Biolegend | RRID: AB_2794320 |
| Brilliant Violet 421 anti-mouse CD19 antibody | Biolegend | RRID: AB_10895761 |
| FITC anti-mouse CD19 antibody | Biolegend | RRID: AB_313641 |
| APC anti-mouse CD19 antibody | Biolegend | RRID: AB_313647 |
| PE Anti-mouse Igκ antibody | Biolegend | RRID: AB_2563581 |
| FITC Anti-mouse Igκ antibody | Biolegend | RRID: AB_2563585 |
| Biotin anti-mouse Igλ antibody | Biolegend | RRID: AB_345332 |
| PE anti-mouse Igλ antibody | Biolegend | RRID: AB_1027659 |
| PE-cy7 anti-mouse CD43 antibody | Biolegend | RRID: AB_2564349 |
| FITC anti-mouse CD2 antibody | Biolegend | RRID: AB_312652 |
| APC anti-mouse CD2 antibody | Biolegend | RRID: AB_2563090 |
| Brilliant Violet 711 anti-mouse c-Kit antibody | Biolegend | RRID: AB_2565956 |
| APC anti-mouse CD25 antibody | Biolegend | RRID: AB_312861 |
| FITC anti-mouse Ly-51(BP-1) antibody | Biolegend | RRID: AB_313362 |
| FITC anti-mouse CD4 antibody | Biolegend | RRID: AB_312691 |
| APC anti-mouse CD24 antibody | Biolegend | RRID: AB_2565651 |
| APC anti-mouse IL-7Rα antibody | Biolegend | RRID: AB_1937216 |
| Biotin anti-mouse Pre-B Cell Receptor antibody | BD Biosciences | RRID: AB_394277 |
| PE anti-mouse VpreB antibody | Biolegend | RRID: AB_11150774 |
| PE anti-Cyclin D3 antibody | Biolegend | RRID: AB_2686980 |
| PE anti-mouse Aiolos (IKZF3) antibody | Biolegend | RRID: AB_2561701 |
| Alexa Fluor 488 Donkey anti-rabbit IgG antibody | Biolegend | RRID: AB_2563203 |
| FITC anti-mouse IgM antibody | BD Biosciences | RRID: AB_394857 |
| Alexa Fluor 488 anti-ERK1/2 (pT202/pY204) antibody | BD Biosciences | RRID: AB_399875 |
| Alexa Fluor 488 anti-STAT5 (pY694) antibody | BD Biosciences | RRID: AB_11154039 |
| Alexa Fluor 488 anti-Akt (pS473) antibody | BD Biosciences | RRID: AB_1645342 |
| FITC anti-BrdU antibody | BD Biosciences | RRID: AB_396304 |
| Rabbit Anti-FoxO1 (C29H4) antibody | Cell Signaling Technology | RRID: AB_2106495 |
| Rabbit anti-METTL3 antibody | Cell Signaling Technology | RRID: AB_2800072 |
| Rabbit anti-METTL14 antibody | Cell Signaling Technology | RRID: AB_2799383 |
| HRP-conjugated Rabbit anti-GAPDH (D16H11) | Cell Signaling Technology | RRID: AB_11129865 |
| HRP-conjugated anti-rabbit IgG | Cell Signaling Technology | RRID: AB_2099233 |
| anti-m6A antibody | New England Biolabs | Catalog#:E1610s |
| anti-YTHDF2 antibody | Aviva Systems Biology | Catalog#:ARP67917_P050 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Recombinant Mouse IL-7 (carrier-free) | Biolegend | Cat#: 577802 |
| 5-Bromo-2’-deoxyuridine (BrdU) | Sigma-Aldrich | Cat#: B5002 |
| TRIzol Reagent | Thermo Fisher Scientific | Cat#: 15596026 |
| Critical Commercial Assays | ||
| FITC BrdU Flow Kit | BD Biosciences | Cat#:559619 |
| CellTrace CFSE Cell Proliferation Kit, for flow cytometry | Invitrogen | Cat#:C34554 |
| Dynabeads mRNA DIRECT Purification Kit | Invitrogen | Cat#:61012 |
| SMARTer Stranded RNA-Seq Kits | Takara | Cat#:634839 |
| EpiMark N6-Methyladenosine Enrichment Kit | New England Biolabs | Cat#: E1610S |
| RNA Clean & Concentractor-5 | Zymo Research | Cat#: R1013 |
| TruSeq Ribo Profile (Mammalian) Library Prep Kit | IIIumina | Cat#: RPYSC12116 |
| RiboMinus Eukaryote System v2 | Invitrogen | Cat#: A15026 |
| ZR small-RNA PAGE Recovery Kit | Zymo Research | Cat#: R1070 |
| NEBNext Small RNA Library Prep Set for Illumina | New England Biolabs | Cat#: E7330L |
| Deposited Data | ||
| Raw data: RNA-seq, ATAC-seq and ribosome profiling of large pre-B cells | This paper | GEO: GSE112022 |
| Raw data: m6A-seq and YTHDF2 RIP-seq of large pre-B cells | This paper | GEO: GSE136419 |
| Raw data: RNA-seq,m6A-seq and YTHDF2 RIP-seq of pro-B cells | This paper | GEO: GSE151071 |
| Experimental Models: Cell Lines | ||
| OP9 cells stromal cells | Gift from Dr Barbara Kee lab | N/A |
| Experimental Models: Organisms/Strains | ||
| Mettl14-floxed mouse | Yoon et al., 2017 | N/A |
| Mb1-cre mouse | Hobeika et al., 2006 | JAX:020505 |
| Ythdf1-KO mouse | Shi et al., 2018 | N/A |
| Ythdf2-floxed mouse | Li et al., 2018a | N/A |
| SWHEL mouse | Phan et al., 2003 | N/A |
| Rag1−/− mouse | Jackson Laboratory | JAX:002216 |
| Oligonucleotides | ||
| Mettl14 flox-Forward common primer: CTGCCAAGAAAATGGGAAAA | This paper | N/A |
| Mettl14 flox-WT&Flox reverse primer: TGCAGCCCCACAATTATAGC | This paper | N/A |
| Mettl14 flox- Deleted reverse primer: GGGACTGGGAACACTTGAAA | This paper | N/A |
| Primer degVk (Vκ1-Jκ1 primer a): GGCT GCAGSTTCAGTGGCAGTGGRTCGGRAC | Johnson et al., 2008 | N/A |
| Primer MAR (Vκ1-Jκ1 primer b): AACAC TGGATAAAGCAGTTTATGCCCTTTC | Johnson et al., 2008 | N/A |
| Primer k-meth-F (Vκ1-Jκ1 primer c): ATGACCCAGAGGATGAAAC | Johnson et al., 2008 | N/A |
| Forward primer for IgH recombination VH7183: CG GTACCAAGAASAMCCTGTWCCTGCAAATGASC | Liu et al., 2007 | N/A |
| Forward primer for IgH recombination VHGam3.8: CAAGGGACGGTTTGCCTTCTCTTTGGAA | Liu et al., 2007 | N/A |
| Forward primer for IgH recombination VHJ558: CGAGCTCTCCARCACAGCCTWCATGCARCTCARC | Liu et al., 2007 | N/A |
| Common reverse primer for IgH recombination: GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG | Liu et al., 2007 | N/A |
| Hprt forward primer: TCCTCCTCAGACCGCTTTT | Inoue et al., 2015 | N/A |
| Hprt forward primer: CCTGGTTCATCATCGCTAATC | Inoue et al., 2015 | N/A |
| Software and Algorithms | ||
| FlowJo 10.0.8r.1 | BD Bioscinces | https://www.flowjo.com/solutions/flowjo/downloads/ |
| FACSDiva V8.0.1 | BD Biosciences | https://www.bdbiosciences.com/en-us/instruments/research-instruments/research-software/flow-cytometry-acquisition/facsdiva-software |
| Microsoft Exel | Microsoft | https://www.microsoft.com/en-us/microsoft-365 |
| GraphPad Prism | GraphPad Software Inc | https://www.graphpad.com/ |
| ABI Prism Sequence Detection v 1.9.1 | Thermo Fisher Scientific | https://www.thermofisher.com/us/en/home/technical-resources/software-downloads/ab-prism-7000-sequence-detection-system.html |
| Trim_galore v0.4.4 | Babraham Bioinformatics | https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ |
| Hisat2 v2.1.0 | Kim et al., 2015 | http://daehwankimlab.github.io/hisat2/ |
| Cufflinks v2.2.1 | Trapnell et al., 2013 | http://cole-trapnell-lab.github.io/cufflinks/releases/v2.2.1/ |
| Cluster 3.0 | Human Genome Center, University of Tokyo | http://bonsai.hgc.jp/~mdehoon/software/cluster/ |
| Java Treeview | Saldanha, 2004 | http://jtreeview.sourceforge.net/ |
| deeptools 2.0 tool suite | Ramírez et al., 2016 | https://deeptools.readthedocs.io/en/develop/ |
| featureCounts from R package Rsubread | Liao et al., 2019 | http://subread.sourceforge.net/ |
| RiboRex | Li et al., 2017b | https://github.com/smithlabcode/riborex |
| exomePeak | Meng et al., 2014 | https://bioconductor.riken.jp/packages/3.8/bioc/html/exomePeak.html |
| DESeq2 | Love et al., 2014 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| HOMER | Heinz et al., 2010 | http://homer.ucsd.edu/homer/ |
| DAVID Bioinformatics Resources 6.8 | Huang et al., 2009 | https://david.ncifcrf.gov/ |
| JUMPp software | Wang et al., 2014a | https://github.com/hongwang198745/HGG_Source_Code |
| Other | ||
| DPBS, no calcium, no magnesium | Thermo Fisher Scientific | Cat#:14190250 |
| FBS | Thermo Fisher Scientific | Cat#:26140 |
| ACK cell lysis buffer | Thermo Fisher Scientific | Cat#: A1049201 |
| CountBright Absolute Counting Beads | Thermo Fisher Scientific | Cat#: C36950 |
| Opti-MEM I Reduced Serum Medium | Thermo Fisher Scientific | Cat#: 31985088 |
| L-Glutamine (200 mM) | Thermo Fisher Scientific | Cat#: 25030081 |
| Penicillin-Streptomycin (10,000 U/mL) | Thermo Fisher Scientific | Cat#: 15140122 |
| 2-Mercaptoethanol (50 mM) | Thermo Fisher Scientific | Cat#: 31350010 |
| Anti-Biotin MicroBeads | Miltenyi Biotec | Cat#:130–105–637 |
| MS Columns | Miltenyi Biotec | Cat#:130–042–201 |
| Fixation/Permeabilization Solution Kit | BD Biosciences | Cat#:554714 |
| True-Nuclear Transcription Factor Buffer Set | Biolegend | Cat#:424401 |
| BD Cytofix buffer | BD Biosciences | Cat#:554655 |
| Perm Buffer III | BD Biosciences | Cat#:558050 |
| Trypsin-EDTA (0.05%), phenol red | Thermo Fisher Scientific | Cat#: 25300120 |
| Nuclease P1 | FUJIFILM Wako Pure Chemical Corporation | Cat#: 145–08221 |
| FastAP Thermosensitive Alkaline Phosphatase | Thermo Fisher Scientific | Cat#: EF0651 |
| Dynabeads Protein G for Immunoprecipitation | Invitrogen | Cat#: 10004D |
| Micro Bio-Spin® Columns with Bio-Gel® P-30 | Bio-Rad | Cat#: 7326223 |