Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
A list of mutations only found in the evolved strains
| Position | Detected sequence | Locus | Mutation | (annotated) Function | Strains |
|---|---|---|---|---|---|
| 7181 | C -> T | ZZ6_0006 | A273T | Carboxymethylenebutenolidase | KFS1 and KFS2 |
| 342703 | C -> T | ZZ6_0303 | G192R | Hypothetical protein | KFS1 and KFS2 |
| 1641047 | A -> AGGCTCAGGACCCATTGATTT | ZZ6_1449 | Insertion at L282, frame shift | Carboxyl-terminal protease | KFS1 and KFS2 |
| 1650537 | C -> T | ZZ6_1458 | G139V | Hypothetical protein | KFS2 |
