REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Fluorescein isothiocyanate (FITC)-conjugated anti-rabies virus nucleoprotein (RABV N) monoclonal globulin	Fujirebio	Cat#800-092; RRID: AB_2802166
U.S. standard rabies immune globulin	Center for Biologics Evaluation & Research, US Food and Drug Administration	Lot R-3
Mouse anti-RABV G mAb 1C5	Abcam	Cat#Ab82460; RRID: AB_1658373
Mouse anti-Lyssavirus G mAb 1409-7	Provided by Dr. Todd Smith, US Centers for Disease Control and Prevention	(Dietzschold et al., 1988)
Human anti-RABV G mAb 4C12	Provided by Dr. Scott Dessain, Lankenau Institute for Medical Research	N/A
Pooled mouse anti-MOKV G sera	Provided by Dr. Gene Tan, J. Craig Venter Institute	N/A
HRP-conjugated goat anti-mouse IgG (H+L)	Jackson Immunoresearch	Cat#115-035-146; RRID: AB_2307392
Cy3-conjugated goat anti-mouse IgG	Jackson Immunoresearch	Cat#115-165-146; RRID: AB_2338690
Bacterial and Virus Strains
Stellar competent cells	Clontech/Takara	Cat#636763
VSVΔG-GFP-RABVG	Schnell Laboratory	(Abreu-Mota et al., 2018)
VSVΔG-NanoLuc-EGFP	Schnell Laboratory	(Abreu-Mota et al., 2018)
MOKV G pseudotype viruses (MOKV G PTVs)	This paper	N/A
Irkut virus (IRKV, RFFIT)	Provided by Dr. Todd Smith, US Centers for Disease Control and Prevention	N/A
European bat lyssavirus 1 (EBLV1, RFFIT)	Provided by Dr. Todd Smith, US Centers for Disease Control and Prevention	N/A
Duvenhage virus (DUVV, 86132SA)	Provided by Dr. Todd Smith, US Centers for Disease Control and Prevention	GenBank: EU293119.1
Lagos bat virus (LBV, lineage B, isolate 8619NGA)	Provided by Dr. Todd Smith, US Centers for Disease Control and Prevention	GenBank: EU293110.1
Lagos bat virus (LBV, lineage D, isolate KE576)	Provided by Dr. Todd Smith, US Centers for Disease Control and Prevention	GenBank: GU170202.1
Shimoni bat virus (SHIBV, Kenya, 2009)	Provided by Dr. Todd Smith, US Centers for Disease Control and Prevention	GenBank: GU170201.1
Mokola virus (MOKV, isolate 252/97)	Provided by Dr. Todd Smith, US Centers for Disease Control and Prevention	GenBank: GQ500112.1
rRABV	This paper	N/A
RABV (CVS-11 strain)	Schnell Laboratory	N/A
RABV (N2c)	Schnell Laboratory	N/A
RABV (SPBN)	Schnell Laboratory	(McGettigan et al., 2001)
Biological Samples
Soluble RABV G	Schnell Laboratory	(Blaney et al., 2013)
Soluble MOKV G	This paper	N/A
Chemicals, Peptides, and Recombinant Proteins
β-propiolactone (BPL)	Sigma	Cat#P5648
SYPRO Ruby Protein Gel Stain	Invitrogen	Cat#S12000
Glucopyranosyl lipid adjuvant-stable emulsion (GLA-SE)	Infectious Disease Research Institute	Cat#EM-082
octyglucopyranoside (OGP)	Fisher	Cat#BP585-5
Vectashield Hard Set containing 4′,6-diamidino-2-phenylindole (DAPI)	Vector Laboratories	Cat#H-1500
SIGMAFAST o-phenylenediamine dihydrochloride (OPD) tablets	Sigma	Cat#P9187-50SET
Passive cell culture lysis buffer	Promega	Cat#E1941
Critical Commercial Assays
SuperScript II Reverse Transcriptase	Invitrogen	Cat#10928-034
Bicinchoninic acid (BCA) assay kit	Pierce	Cat#23250
Nano-Glo Luciferase Assay System	Promega	Cat#N113
Experimental Models: Cell Lines
Mouse neuroblastoma (NA) cells	Schnell Laboratory	N/A
BSR cells (derivative of BHK-21)	Schnell Laboratory	N/A
Vero cells	ATCC	CCL81
BEAS-2b cells	ATCC	CRL-9609
Experimental Models: Organisms/Strains
Swiss Webster mice	Charles River	24107540
Oligonucleotides
MOKV G forward oligo (CO-041) 5′- TAACACCCCTCCCGTACGACCA TGAACCTACCCTGTCTGAC-3′	IDT	N/A
MOKV G reverse oligo (CO-042) 5′ GTGTTAGTTTTTTTCATGGCTAGC TCATGTACCAGGGAGC-3′	IDT	N/A
Fragment 1 forward oligo for Chimeric G 1 (CO-062) 5′-TTGGCAAAGAATTCG AGCTCCGTACGGCCGCCACCATG-3′	IDT	N/A
Fragment 1 reverse oligo for Chimeric G 1 (CO-063) 5′-GTTGCAGCCCTCCTC CTCGACCACCAGATTGTTA-3′	IDT	N/A
Fragment 2 forward oligo for Chimeric G 1 (CO-064) 5′- GAGGAGGGCTGCA ACGCC-3′	IDT	N/A
Fragment 2 reverse oligo for Chimeric G 1 (CO-065) 5′- CCTGAAGTCGTGCAGA TTGACCAGCTGGTTGGG-3′	IDT	N/A
Fragment 3 forward oligo for Chimeric G 1 (CO-066) 5′- CTGCACGACTTCA GGAGC-3′	IDT	N/A
Fragment 3 reverse oligo for Chimeric G 1 and Fragment 4 reverse oligo for Chimeric G 2 (CO-067) 5′- AAAAAGATCTGCTAGCTC ACAGCCTGGTCTCGCC-3′	IDT	N/A
Fragment 1 forward oligo for Chimeric G 2 (CO-068) 5′- TTGGCAAAGAATTCGAG CTCCGTACGAAAAAGCGGCCG-3′	IDT	N/A
Fragment 1 reverse oligo for Chimeric G 2 (CO-069) 5′- GGTACACCCTTCGTCTTG GGAGAGCAGATTATTCG-3′	IDT	N/A
Fragment 2 forward oligo for Chimeric G 2 (CO-070) 5′- GACGAAGGGTGTA CCAAC-3′	IDT	N/A
Fragment 2 reverse oligo for Chimeric G 2 (CO-071) 5′- GCGGTCATTGTGTAT ATTCACCAGTTTGTCAGGG-3′	IDT	N/A
Fragment 3 forward oligo for Chimeric G 2 (CO-072) 5′- ATACACAATGACC GCCTTG-3′	IDT	N/A
Fragment 3 reverse oligo for Chimeric G 2 (CO-073) 5′- CACTGTGGAGGGATCA ATCAGAGGGTGTCGCAAT-3′	IDT	N/A
Fragment 4 forward oligo for Chimeric G 2 (CO-074) 5′- GATCCCTCCACAGTGTTC-3′	IDT	N/A
Forward RT-PCR primer for amplifying G in RABV vectors 5′- GGAGGTCGACTAA AGAGATCTCACATAC-3′	IDT	N/A
Reverse RT-PCR primer for amplifying G in RABV vectors 5′- TTCTTCAGCCATCTCA AGATCGGCCAGAC	IDT	N/A
Recombinant DNA
BNSPΔG cDNA	Schnell Laboratory	(Blaney et al., 2011)
BNSP333 cDNA	Schnell Laboratory	(Blaney et al., 2011)
rRABV cDNA	This paper	N/A
rMOKV cDNA	This paper	N/A
rChimera1 cDNA	This paper	N/A
rChimera2 cDNA	This paper	N/A
pCAGGS-coMOKVG	Provided by Dr. Gene Tan, J. Craig Venter Institute	MOKV.NIG68-RV4 strain (Wright et al., 2010), GenBank accession number HM623780
pCAGGS-coRABVG	This paper	N/A
pCAGGS-ChimericG1	This paper	N/A
pCAGGS-ChimericG2	This paper	N/A
pTIT-RABVN	Schnell Laboratory	(Gomme et al., 2010)
pTIT-RABVP	Schnell Laboratory	(Gomme et al., 2010)
pTIT-RABVL	Schnell Laboratory	(Gomme et al., 2010)
pCAGGS-T7	Schnell Laboratory	(Gomme et al., 2010)
Software and Algorithms
Fiji	https://imagej.net/Fiji	(Schindelin et al., 2012)
I-TASSER	https://zhanglab.ccmb.med.umich.edu/I-TASSER/	(Zhang, 2008)
SWISS-MODEL	https://swissmodel.expasy.org/	(Waterhouse et al., 2018)
Phyre2	http://www.sbg.bio.ic.ac.uk/∼phyre2/html/page.cgi?id=index	(Kelley et al., 2015)
GraphPad Prism for macOS (Version 8)	https://www.graphpad.com/	N/A
The PyMOL Molecular Graphics System, Version 2 by Schrödinger, LLC.	https://pymol.org/2/	N/A
Other
InFusion Cloning Kit	Clontech/Takara	Cat#639649
X-tremeGENE 9 transfection reagent	Millipore Sigma	Cat#06365809001
PureLink RNA Mini Kit	Ambion	Cat#12183018A