Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Primer | Sequence 5´-3´ | Nucleotide position | Product length |
|---|---|---|---|
| arnBF | CCAAAGCGATTGTTCCGGTG | 365–384 | 169 bp |
| arnBR | AAAGAGAAAATCGCCGTGCC | 609–590 | |
| 16SF | ATTCCAGGTGTAGCGGTGAA | 646–665 | 238 bp |
| 16SR | TGAGTTTTAACCTTGCGGCC | 883–864 |
16SF: 16S gene forward primer; 16SR: 16S gene reverse primer; arnBF: arnB gene forward primer; arnBR: arnB gene reverse primer; bp: base pairs.
