Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (H. sapiens) |
HEK293T | ATCC | CRL-3216; RRID:CVCL_0063 | |
| Cell line (H. sapiens) | Flp-In T-REx 293 | Thermo Fisher |
R78007; RRID:CVCL_U427 |
|
| Cell line (H. sapiens) | Flp-In T-REx 293 GFP-P2A-(KAAA)21-P2A-RFP | Juszkiewicz and Hegde, 2017 | ||
| Cell line (H. sapiens) | Flp-In T-REx 293 TRex GFP-P2A-(K)0-P2A-RFP | Juszkiewicz and Hegde, 2017 | ||
| Cell line (H. sapiens) | Flp-In T-REx 293 GFP-P2A-(KAAA)21-P2A-RFP ∆ZNF598 | Juszkiewicz and Hegde, 2017 | ||
| Cell line (H. sapiens) | Flp-In T-REx 293 GFP-P2A-(KAAA)21-P2A-RFP ∆GIGYF2 | This paper | CRISPR/Cas9 targeting GIGYF2, clonal selection | |
| Cell line (H. sapiens) | Flp-In T-REx 293 GFP-P2A-(KAAA)21-P2A-RFP ∆EDF1 | This paper | CRISPR/Cas9 targeting EDF1, clonal selection | |
| Antibody | anti-ZNF598 (rabbit polyclonal) | Abcam | Cat #ab80458; RRID:AB_2221273 | WB (1:500) |
| Antibody | anti-uL2 (rabbit polyclonal) | Abcam | Cat #ab169538; RRID:AB_2714187 | WB (1:10000) |
| Antibody | anti-eS24 (rabbit polyclonal) | Abcam | Cat #ab196652; RRID:AB_2714188 | WB (1:2500) |
| Antibody | HRP-conjugated anti-FLAG (mouse monoclonal) | Sigma | cat #A8592; RRID:AB_439702 | WB (1:5000) |
| Antibody | anti-eS10 (rabbit monoclonal) | Abcam | cat #ab151550; RRID:AB_2714147 | WB (1:5000 – unmodified eS10; 1:250 – Ub-eS10) |
| Antibody | HRP-conjugated anti-beta-Actin (mouse monoclonal) | Sigma | cat #A3854; RRID:AB_262011 | WB (1:10000) |
| Antibody | anti-GIGYF2 (rabbit polyclonal) | Bethyl | cat #A303-732A; RRID:AB_11205815 | WB (1:2000) |
| Antibody | anti-EDF1 (rabbit polyclonal) | Bethyl | cat #A304-039A; RRID:AB_2621288 | WB (1:1000) |
| Antibody | anti-RACK1 (rabbit polyclonal) | Bethyl | cat #A302-545A; RRID:AB_1999012 | WB (1:2000) |
| Antibody | anti-4EHP (rabbit polyclonal) | GeneTex | cat #GTX103977; RRID:AB_2036842 | WB (1:250) |
| Antibody | anti-GFP (rabbit polyclonal) | Chakrabarti and Hegde, 2009 | WB (1:5000) | |
| Antibody | HRP-conjugated anti-mouse (goat polyclonal) | Jackson ImmunoResearch | cat #115-035-003; RRID:AB_10015289 | WB (1:5000) |
| Antibody | HRP-conjugated anti-rabbit (goat polyclonal) | Jackson ImmunoResearch | cat# 111-035-003; RRID:AB_2313567 | WB (1:5000) |
| Recombinant DNA reagent | pX459-EDF1- sgRNA1 | This paper | sgRNA targeting EDF1 | |
| Recombinant DNA reagent | pX459-EDF1- sgRNA2 | This paper | sgRNA targeting EDF1 | |
| Recombinant DNA reagent | pX459-GIGYF2- sgRNA1 | This paper | sgRNA targeting GIGYF2 | |
| Recombinant DNA reagent | pX459-GIGYF2- sgRNA2 | This paper | sgRNA targeting GIGYF2 | |
| Recombinant DNA reagent | pcDNA3.1-ZNF598-TEV-3xFLAG | Juszkiewicz and Hegde, 2017 | RRID:Addgene_105690 | Human ZNF598 with TEV-3xFLAG tag at the C-terminus for mammalian expression |
| Recombinant DNA reagent | pcDNA3.1-EDF1-TEV-3xFLAG | This paper | Human EDF1 tagged with TEV-3xFLAG at the C-terminus for mammalian expression | |
| Recombinant DNA reagent | pcDNA3.1-EDF1-GFP | This paper | Human EDF1 tagged with GFP at the C-terminus for mammalian expression | |
| Recombinant DNA reagent | pCMV-4EHP-HA | This paper | Human 4EHP tagged with HA at the C-terminus for mammalian expression | |
| Recombinant DNA reagent | pcDNA3.1-4EHP-P2A-Twin-Strep-GIGYF2 | This paper | Human 4EHP and Twin-Strep tagged GIGYF2 for mammalian expression | |
| Recombinant DNA reagent | pcDNA3.1-EDF1(R85G)-TEV-3xFLAG | This paper | Human EDF1 R85G mutant tagged with TEV-3xFLAG at the C-terminus for mammalian expression | |
| Recombinant DNA reagent | pSP64-EDF1-TST | This paper | Human EDF1 tagged with C-terminal TST for in vitro transcription and translation |
|
| Recombinant DNA reagent | pSP64-EDF1(R85G)-TST | This paper | Human EDF1 R85G mutant with C-terminal TST for in vitro transcription and translation | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-K(AAA)12+0-RFP | Juszkiewicz and Hegde, 2017 | Frameshifting reporters based on K12 poly sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-K(AAA)12+1-RFP | Juszkiewicz and Hegde, 2017 | Frameshifting reporters based on K12 poly sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-K(AAA)12–1-RFP | Juszkiewicz and Hegde, 2017 | Frameshifting reporters based on K12 poly sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-WT_XBP1_4AAA+0-RFP | This paper | Frameshifting reporterts based on XBP1 stalling sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-S255A_XBP1_4AAA+0-RFP | This paper | Frameshifting reporterts based on XBP1 stalling sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-W256A_XBP1_4AAA+0-RFP | This paper | Frameshifting reporterts based on XBP1 stalling sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-WT_XBP1_4AAA+1-RFP | This paper | Frameshifting reporterts based on XBP1 stalling sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-S255A_XBP1_4AAA+1-RFP | This paper | Frameshifting reporterts based on XBP1 stalling sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-W256A_XBP1_4AAA+1-RFP | This paper | Frameshifting reporterts based on XBP1 stalling sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-WT_XBP1_4AAA-1-RFP | This paper | Frameshifting reporterts based on XBP1 stalling sequence | |
| Recombinant DNA reagent | pCMV-GFP-P2A-3XFLAG-VHPb-S255A_XBP1_4AAA-1-RFP | This paper | Frameshifting reporterts based on XBP1 stalling sequence | |
| Recombinant DNA reagent | GFP-P2A-3XFLAG-VHPb-W256A_XBP1_4AAA-1-RFP | This paper | Frameshifting reporterts based on XBP1 stalling sequence | |
| Recombinant DNA reagent | pRSETA 6xHIS-TEV-eRF1(AAQ) | Brown et al., 2015 | Human mutant eRF1(AAQ) for expression in E. coli |
|
| Sequence-based reagent | CRISPR: EDF1 sgRNA1 | IDT | 5' - ATCTTAGCGGCACAGAGACG - 3' | |
| Sequence-based reagent | CRISPR: EDF1 sgRNA1 | IDT | 5' - GAGCAAGGGGCTTACGCAGA - 3' | |
| Sequence-based reagent | CRISPR: GIGYF2 sgRNA1 | IDT | 5' - GGGAACACATGGAACGACGT - 3' | |
| Sequence-based reagent | CRISPR: GIGYF2 sgRNA2 | IDT | 5' - GGCGACTAGCTGGATCAAGG - 3' | |
| Sequence-based reagent | siRNA: control | Thermo Fisher | 4390843 | Silencer Select |
| Sequence-based reagent | siRNA: EDF1 #1 | Thermo Fisher | #16610 | Silencer Select |
| Sequence-based reagent | siRNA: EDF1 #2 | Thermo Fisher | #s225027 | Silencer Select |
| Sequence-based reagent | siRNA: GIGYF2 #1 | Thermo Fisher | #s25033 | Silencer Select |
| Sequence-based reagent | siRNA: GIGYF2 #2 | Thermo Fisher | #s25034 | Silencer Select |
| Sequence-based reagent | siRNA: ZNF598 | Thermo Fisher | #s40509 | Silencer Select |
| Sequence-based reagent | siRNA: 4EHP | Thermo Fisher | #s18149 | Silencer Select |
| Sequence-based reagent | siRNA: 4EHP | Thermo Fisher | #s18150 | Silencer Select |
| Sequence-based reagent | GAPDH Forward primer for RT-PCR | IDT | 5’-AGCTCATTTCCTGGTATGACA-3’ | |
| Sequence-based reagent | GAPDH Reverse primer for RT-PCR | IDT | 5’-AGGGGAGATTCAGTGTGGTG-3’ | |
| Sequence-based reagent | RPLP1 Forward primer for RT-PCR | IDT | 5’-CTCACTTCATCCGGCGACTAG-3’ | |
| Sequence-based reagent | RPLP1 Reverse primer for RT-PCR | IDT | 5’-GCAGAATGAGGGCCGAGTAG-3’ | |
| Sequence-based reagent | GFP Forward primer for RT-PCR | IDT | 5’-GGCAAGCTGACCCTGAAGTT-3’ | |
| Sequence-based reagent | GFP Reverse primer for RT-PCR | IDT | 5’-CTTGTAGTTGCCGTCGTCCT-3’ | |
| Sequence-based reagent | RFP Forward primer for RT-PCR | IDT | 5’-AGCAAGGGCGAGGAGGATAA-3’ | |
| Sequence-based reagent | RFP Reverse primer for RT-PCR | IDT | 5’- TAGGCCTTGGAGCCGTACAT-3’ | |
| Peptide, recombinant protein | S7 Micrococcal Nuclease | Roche | Cat #11873580001 | purified protein |
| Chemical compound, drug | Hygromycin B | Millipore | Cat #400051-100KU | Selection antibiotic |
| Chemical compound, drug | Blasticidin S | Santa Cruz Biotechnology | Cat #sc204655 | Selection antibiotic |
| Chemical compound, drug | Emetine | Calbiochem | Cat #324693 | Used to induce ribosomal stalling |
| Software, algorithm | FlowJo | FlowJo | RRID:SCR_008520 | Analysis of FACS data |
| Software, algorithm |
GraphPad Prism | GraphPad Prism | RRID:SCR_008520 | Statistical analysis, graphs |
| Other | Complete EDTA-free protease inhibitor cocktail | Roche | Cat #118735800001 |