| Antibodies |
| Rabbit polyclonal anti-ACIII |
Proteintech |
Cat# 19492–1-AP; RRID:AB„10638445 |
| Rabbit monoclonal anti-centrin |
Millipore |
Cat# 04–1624; RRID:AB_10563501 |
| Rabbit polyclonal anti-Hp90 |
Proteintech |
Cat#13171–1-AP; RRID:AB_2120924 |
| Rabbit monoclonal antl-GAPDH |
Ambion |
Cat# AM4300; RRID:AB_437392 |
| Rabbit polyclonal anti-pS6 |
Cell Signaling Technology |
Cat# 5364; RRID:AB_10694233 |
| Mouse monoclonal anti-S6 |
Santa Cruz Biotechnology |
Cat# sc-74459; RRID:AB_1129205 |
| Rabbit polyclonal anti-phospho Akt (Ser473) |
Cell Signaling Technology |
Cat# 4060; RRID:AB_2315049 |
| Rabbit monoclonal anti-Akt |
Cell Signaling Technology |
Cat# 4691; RRID:AB_91578 |
| Rabbit polyclonal anti-phospho PRAS40 (Thr246) |
Cell Signaling Technology |
Cat#13175; RRID:AB_2798140 |
| Rabbit polyclonal anti-PRAS40 |
Cell Signaling Technology |
Catt# 2691; RRID:AB_2225033 |
| Rabbit polyclonal anti-phospho IGF-IRβ(Tyr1335/6) |
Cell Signaling Technology |
Cat# 3024S; RRID:AB_331253 |
| Rabbit polyclonal anti-IGF-IRβ |
Santa Cruz Biotechnology |
Cat# sc-713; RRID:AB_671792 |
| Rabbit polyclonal anti-Tsc2 |
Cell Signaling Technology |
Cat# 4308; RRID:AB_10547134 |
| Rabbit monoclonal anti-Hsp70 |
Santa Cruz Biotechnology |
Cat# sc-24; RRID:AB_627760 |
| Rabbit monoclonal anti-Hsp60 |
Santa Cruz Biotechnology |
Cat# sc-271215; RRID:AB_10607973 |
| Rabbit monoclonal anti-Hsp27 |
Santa Cruz Biotechnology |
Cat# sc-13132; RRID:AB_627755 |
| Chicken polyclonal anti-GFP |
Thermo Fisher Scientific |
Cat# A10262; RRID:AB_2534023 |
| Mouse monoclonal anti-RFP |
Thermo Fisher Scientific |
Cat# MA515257; RRID;AB_10999796 |
| Goat anti-mouse IRDye 800RD |
LI-COR Biosciences |
Cat#925–32210; RRID:AB_2687825 |
| Goat anti-mouse IRDye 680RD |
LI-COR Biosciences |
Cat#925–68070; RRID:AB_2651128 |
| Goat anti-rabbit IRDye 800CW |
LI-COR Biosciences |
Cat#925–32211; RRID:AB_2651127 |
| Goat anti-rabbit IRDye 680RD |
LI-COR Biosciences |
Cat#925–68071; RRID:AB_2721181 |
| Goat anti-chicken Alexa Fluor-488 |
Molecular Probes |
Cat#A11039; RRID:AB_.142924 |
| Goat anti-rabbit Alexa Fluor-647 |
Molecular Probes |
Cat# A21244; RRID:AB_141663 |
| Goat anti-rabbit Alexa Fluor-546 |
Molecular Probes |
Cat#A11035; RRID:AB_143051 |
| Goat anti-mouse Alexa Fluor-546 |
Molecular Probes |
Cat#A11030; RRID:AB_144695 |
| Bacterial and Virus Strains |
| Stbl3 competent cells |
Thermo Fisher Scientific |
Cat# C737303 |
| NEB Stable competent cells |
New England Biolabs |
Cat#C30401
|
| Tsc2-sh-GFP |
Previously reported (See text for details) |
N/A |
| Hsp27-shRNA |
Sigma |
Cat#TRCN0000321339 |
| Biological Samples |
| Sprague-Dawley rat brain tissue |
Charles River Laboratories |
N/A |
| TSC patient brain tissue |
BCH Repository, Table S2
|
N/A |
| Non-TSC patient brain tissue |
BCH Repository, Table S2
|
N/A |
| Chemicals, Peptides, and Recombinant Proteins |
| BIOMOL ICCB-L Known Bioactive 2012 library |
ICCB-Longwood |
https://iccb.med.harvard.edu/biomol-iccb-l-known-bioactives-2012 |
| Rapamycin |
LC Laboratories |
Cat# R-5000 |
| 17-Allylamino- geldanamycin (17-AGG) |
Enzo Life Sciences |
Cat# BML- EI308–0001 |
| Geldanamycin (GA) |
Enzo Life Sciences |
Cat# BML- EI280–0001 |
| Poly-D-Lysine Hydrobromide |
MP Biomedical |
Cat# 102694 |
| Bortezomib |
EMD Millipore |
Cat# 5.04314.0001 |
| Critical Commercial Assays |
| Pure Link Plasmid Kit |
Thermo Fisher Scientific |
Cat#K21007 |
| Direct-zol™ RNA Miniprep Kit |
Zymo-Research |
Cat# R2052 |
| iScript™ cDNA Synthesis Kit |
BIO-RAD |
Cat# 1708891 |
| PowerUP™ SYBR™ Green Master Mix |
Thermo Fisher Scientific |
Cat# A25742 |
| Deposited Data |
| RNA sequencing data |
Previously reported (See text for details) |
N/A |
| Cilia genes expression data |
This study |
Table S1 |
| Primary screen data |
This study |
Table S3 |
| Mendeley Data |
This study |
https://data.mendeley.com/datasets/p45bhvf2g3/draft?a=420877d4-d4cb-45f1-adb7-91fcefcec901 |
| Experimental Models: Cell Lines |
| HEK293T |
ATCC |
Cat# CRL-3216, RRID: CVCL_0063 |
| Experimental Models: Organisms/Strains |
| Mouse: Tsc1tm1Djk/J |
The Jackson Laboratory |
IMSR Cat# JAX:005680, RRID:IMSR_JAX:005680 |
| Mouse: Tsc2tm1Djk/J |
The Jackson Laboratory |
IMSR Cat# JAX:004686, RRID:IMSR_JAX:004686 |
| Mouse: Tsc2tm2.1Djk/Mmjax |
The Jackson Laboratory |
IMSR Cat# JAX: 037154,. RRID:MMRRC_037154-JAX |
| Mouse: B6.Cg-Tg(Syn1-cre)671 Jxm/J |
The Jackson Laboratory |
IMSR Cat# JAX:003966, RRID:IMSR_JAX:003966 |
| Oligonucleotides |
| GAPDH forward primer: 5′-TGTGTCCGTCGTGGATCT GA-3′ |
This study |
N/A |
| GAPDH reverse primer: 5′-CCTGCTTCACCACCTTCTTGA-3′ |
This study |
N/A |
| hspB1 forward primer: AGACCAAGGAAGGCGTGGTG |
This study |
N/A |
| hspB1 reverse primer: CACACCTGGAGGGAGCGTGT |
This study |
N/A |
| Recombinant DNA |
| pLKO-RFP-shCntrl |
Addgene |
RRID:Addgene_69040 |
| Luciferase-ctrl-sh-GFP |
Previously reported (See text for details) |
N/A |
| psPAX2 |
Addgene |
RRID:Addgene_12260. |
| pMD2.G |
Addgene |
RRID:Addgene_12259. |
| Software and Algorithms |
| Fiji Software v2.0.0 |
Open Source |
http://fiji.se/.RRID:SCR_002285 |
| GraphPad PRISM v8.2.1 |
GraphPad Software |
https://www.graphpad.com/scientific-software/prism/RRID:SCR_002798. |
| HCS Studio™ Cell Analysis Software v6.6.0 |
Thermo Fisher Scientific |
N/A |
| Image Studio Lite analysis software v5.2.5 |
LI-COR |
https://www.licor.com |
| Photoshop CS5.1 v12.1 |
Adobe |
https://www.adobe.com/products/photoshop.html |
| Syscilia. |
Open Source |
http://www.syscilia.org/goldstandard.shtml. |
