Table 1.
Primers for cloning the viperin gene
| Primer set | Accession no. | Primer sequence (5′- 3′) | Tm (°C) |
|---|---|---|---|
| Viperin-T | NM_213817.1 | F: ACCTGCTGCCATGTGGACACTGGTA | 56 |
| R: GCTCAGCTCTCAGCTTCACCAGTCC |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.