KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-mouse IL6 | eBioscience | Cat. # 14-7061-85 |
| Biotin-conjugated anti-IL6 | BD Pharmingen | Cat. # 554402 |
| HRP-conjugated streptavidin | BD Bioseiences | Cat. # 554066 |
| Anti-mouse TNFa | eBioscience | Cat. # 14-7423-85 |
| Anti-mouse IL-1β | Invitrogen | Cat. # 14-7012-81 |
| Biotin-conjugated anti-TNFa | Invitrogen | Cat. # 13-7349-81 |
| Biotin-conjugated anti-IL-1β | eBioscience | Cat. # 13-7112-85 |
| InVivoMAb anti-mouse IL-6R | Bio X Cell | Cat. # BE0047 |
| InVivoMAb rat IgG2b isotype control, anti-keyhole limpet hemocyanin | Bio X Cell | Cat. # BE0090 |
| Bacterial and Virus Strains | ||
| N/A | ||
| Biological Samples | ||
| Human plasma | Yale Stress Center | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Recombinant mouse IL6 | R & D | Cat. # 406-ML |
| Recombinant mouse TNFa | R & D | Cat. # 410-MY |
| Recombinant mouse IL-1β | R & D | Cat. # 401-ML-010 |
| NEFA standard solution | Wako Diagnostics | Cat. # 276-76491 |
| HR series NEFA-HR(2) color reagent A | Wako Diagnostics | Cat. # 999-34691 |
| HR series NEFA-HR(2) solvent A | Wako Diagnostics | Cat. # 995-34791 |
| HR series NEFA-HR(2) color reagent B | Wako Diagnostics | Cat. # 991-34891 |
| HR series NEFA-HR(2) solvent B | Wako Diagnostics | Cat. # 993-35191 |
| Multi-calibrator lipid | Wako Diagnostics | Cat. # 464-01601 |
| L-type triglyceride M enzyme color A | Wako Diagnostics | Cat. # 994-02891 |
| L-type triglyceride M enzyme color B | Wako Diagnostics | Cat. # 990-02991 |
| Intralipid 20% | Sigma-Aldrich | Cat. # 1141 |
| Poloxamer 407 | Sigma-Aldrich | Cat. # 16758 |
| Glucose, D-[3-3H] | PerkinElmer | Cat. # NET331C250UC |
| Potassium palmitate (U-13C16) | Cambridge Isotope Laboratories | Cat. # CLM-3943-PK |
| Sodium L-lactate-3-13C solution | Sigma-Aldrich | Cat. # 490040 |
| 6-hydroxydopamine | Sigma-Aldrich | Cat. # H4381 |
| Lipopolysaccharides from Escherichia coli O55:B5 | Sigma-Aldrich | Cat. # L2880 Lot #: 039M4004V |
| Isoproterenol | Sigma-Aldrich | Cat. # 1351005 |
| CL316243 | Sigma-Aldrich | Cat. # C5976 |
| Propranolol | Sigma-Aldrich | Cat. # P0884 |
| SR59203A | Cayman Chemical | Cat. # 21407 |
| Critical Commercial Assays | ||
| Mouse cytokine array/chemokine array 44-plex (MD44) | Eve Technologies | N/A |
| Human cytokine array/chemokine array 42-plex with IL-18(HD42) | Eve Technologies | N/A |
| Glycerol assay kit | Sigma-Aldrich | Cat. # MAK117-1KT |
| β-hydroxybutyrate colorimetric assay kit | Cayman Chemical | Cat. # 700190 |
| Corticosterone ELISA kit | Enzo Life Sciences | Cat. # ADI-900-097 |
| Mouse insulin ELISA kit | Crystal Chem | Cat. # 90080 |
| Noradrenaline ELISA kit | Eagle Biosciences | Cat. # NOR31-K01 |
| Mouse CTnI | Life Diagnostics | Cat. # CTNI-1-US |
| Alanine transaminase colorimetric activity assay kit | Cayman Chemical | Cat. # 700260 |
| Deposited Data | ||
| N/A | ||
| Experimental Models: Cell Lines | ||
| N/A | ||
| Experimental Models: Organisms/Strains | ||
| Mouse: C57BL/6J | The Jackson Laboratory | 00064 |
| Mouse: Adrb1tm1Bkk Adrb2tm1Bkk | The Jackson Laboratory | 003810 |
| Mouse: B6.129-Ucp1 tm1KZ | The Jackson Laboratory | 003124 |
| Mouse: B6;SJL-Il6ratm11Drew / J | The Jackson Laboratory | 12944 |
| Mouse: B6. FVB(129)-Tg(Alb-cre)1Dlr / J | The Jackson Laboratory | 016832 |
| Mouse: B6. 129-Tg(Adipo q-cre/Esr1*)1Evdr / J | The Jackson Laboratory | 024671 |
| Mouse: Adrenalectomy and sham surgery | The Jackson Laboratory | https://www.jax.org/jax-mice-and-services/find-and-order-jax-mice/surgical-and-preconditioning-services/surgical-service-for-jax-mice |
| Oligonucleotides | ||
| Primers for mouse Il6 Forward | This paper | TGAACAACGATGATGCACTTG |
| Primers for mouse Il6 Reverse | This paper | CTGAAGGACTCTGGCTTTGTC |
| Primers for mouse Il6ra Forward | This paper | AGACCTGGGACCCGAGTTAC |
| Primers for mouse Il6ra Reverse | This paper | AAGGTCAAGCTCCTCCTTCC |
| Primers for mouse Fbp1 Forward | This paper | TGGTTCCGATGGACACAAGG |
| Primers for mouse Fbp1 Reverse | This paper | CCAATGTGACTGGGGATCAAG |
| Primers for mouse Gck Forward | This paper | TTACACTGGCCTCCTGATGG |
| Primers for mouse Gck Reverse | This paper | TTTGCAACACTCAGCCAGAC |
| Primers for mouse Ucp1 Forward | This paper | GTGAACCCGACAACTTCCGAA |
| Primers for mouse Ucp1 Reverse | This paper | TGCCAGGCAAGCTGAAACTC |
| Primers for Pck1, G6p, Pcx, Adrb3, Adrb1, Adrb2, Rpl13a, Ikkb, Tnfa, Cxcl1, Mx1, Il12b, Saa3, Prdm16, Il5, Ssa3, Socs3, See Table S1 | This paper | N/A |
| Recombinant DNA | ||
| N/A | ||
| Software and Algorithms | ||
| Prism 8.0 | GraphPad Software, Inc. | N/A |
| Other | ||
| N/A | ||