Skip to main content
. Author manuscript; available in PMC: 2021 Jul 23.
Published in final edited form as: Cell. 2020 Jun 30;182(2):372–387.e14. doi: 10.1016/j.cell.2020.05.054

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Anti-mouse IL6 eBioscience Cat. # 14-7061-85
Biotin-conjugated anti-IL6 BD Pharmingen Cat. # 554402
HRP-conjugated streptavidin BD Bioseiences Cat. # 554066
Anti-mouse TNFa eBioscience Cat. # 14-7423-85
Anti-mouse IL-1β Invitrogen Cat. # 14-7012-81
Biotin-conjugated anti-TNFa Invitrogen Cat. # 13-7349-81
Biotin-conjugated anti-IL-1β eBioscience Cat. # 13-7112-85
InVivoMAb anti-mouse IL-6R Bio X Cell Cat. # BE0047
InVivoMAb rat IgG2b isotype control, anti-keyhole limpet hemocyanin Bio X Cell Cat. # BE0090
Bacterial and Virus Strains
N/A
Biological Samples
Human plasma Yale Stress Center N/A
Chemicals, Peptides, and Recombinant Proteins
Recombinant mouse IL6 R & D Cat. # 406-ML
Recombinant mouse TNFa R & D Cat. # 410-MY
Recombinant mouse IL-1β R & D Cat. # 401-ML-010
NEFA standard solution Wako Diagnostics Cat. # 276-76491
HR series NEFA-HR(2) color reagent A Wako Diagnostics Cat. # 999-34691
HR series NEFA-HR(2) solvent A Wako Diagnostics Cat. # 995-34791
HR series NEFA-HR(2) color reagent B Wako Diagnostics Cat. # 991-34891
HR series NEFA-HR(2) solvent B Wako Diagnostics Cat. # 993-35191
Multi-calibrator lipid Wako Diagnostics Cat. # 464-01601
L-type triglyceride M enzyme color A Wako Diagnostics Cat. # 994-02891
L-type triglyceride M enzyme color B Wako Diagnostics Cat. # 990-02991
Intralipid 20% Sigma-Aldrich Cat. # 1141
Poloxamer 407 Sigma-Aldrich Cat. # 16758
Glucose, D-[3-3H] PerkinElmer Cat. # NET331C250UC
Potassium palmitate (U-13C16) Cambridge Isotope Laboratories Cat. # CLM-3943-PK
Sodium L-lactate-3-13C solution Sigma-Aldrich Cat. # 490040
6-hydroxydopamine Sigma-Aldrich Cat. # H4381
Lipopolysaccharides from Escherichia coli O55:B5 Sigma-Aldrich Cat. # L2880
Lot #: 039M4004V
Isoproterenol Sigma-Aldrich Cat. # 1351005
CL316243 Sigma-Aldrich Cat. # C5976
Propranolol Sigma-Aldrich Cat. # P0884
SR59203A Cayman Chemical Cat. # 21407
Critical Commercial Assays
Mouse cytokine array/chemokine array 44-plex (MD44) Eve Technologies N/A
Human cytokine array/chemokine array 42-plex with IL-18(HD42) Eve Technologies N/A
Glycerol assay kit Sigma-Aldrich Cat. # MAK117-1KT
β-hydroxybutyrate colorimetric assay kit Cayman Chemical Cat. # 700190
Corticosterone ELISA kit Enzo Life Sciences Cat. # ADI-900-097
Mouse insulin ELISA kit Crystal Chem Cat. # 90080
Noradrenaline ELISA kit Eagle Biosciences Cat. # NOR31-K01
Mouse CTnI Life Diagnostics Cat. # CTNI-1-US
Alanine transaminase colorimetric activity assay kit Cayman Chemical Cat. # 700260
Deposited Data
N/A
Experimental Models: Cell Lines
N/A
Experimental Models: Organisms/Strains
Mouse: C57BL/6J The Jackson Laboratory 00064
Mouse: Adrb1tm1Bkk Adrb2tm1Bkk The Jackson Laboratory 003810
Mouse: B6.129-Ucp1 tm1KZ The Jackson Laboratory 003124
Mouse: B6;SJL-Il6ratm11Drew / J The Jackson Laboratory 12944
Mouse: B6. FVB(129)-Tg(Alb-cre)1Dlr / J The Jackson Laboratory 016832
Mouse: B6. 129-Tg(Adipo q-cre/Esr1*)1Evdr / J The Jackson Laboratory 024671
Mouse: Adrenalectomy and sham surgery The Jackson Laboratory https://www.jax.org/jax-mice-and-services/find-and-order-jax-mice/surgical-and-preconditioning-services/surgical-service-for-jax-mice
Oligonucleotides
Primers for mouse Il6 Forward This paper TGAACAACGATGATGCACTTG
Primers for mouse Il6 Reverse This paper CTGAAGGACTCTGGCTTTGTC
Primers for mouse Il6ra Forward This paper AGACCTGGGACCCGAGTTAC
Primers for mouse Il6ra Reverse This paper AAGGTCAAGCTCCTCCTTCC
Primers for mouse Fbp1 Forward This paper TGGTTCCGATGGACACAAGG
Primers for mouse Fbp1 Reverse This paper CCAATGTGACTGGGGATCAAG
Primers for mouse Gck Forward This paper TTACACTGGCCTCCTGATGG
Primers for mouse Gck Reverse This paper TTTGCAACACTCAGCCAGAC
Primers for mouse Ucp1 Forward This paper GTGAACCCGACAACTTCCGAA
Primers for mouse Ucp1 Reverse This paper TGCCAGGCAAGCTGAAACTC
Primers for Pck1, G6p, Pcx, Adrb3, Adrb1, Adrb2, Rpl13a, Ikkb, Tnfa, Cxcl1, Mx1, Il12b, Saa3, Prdm16, Il5, Ssa3, Socs3, See Table S1 This paper N/A
Recombinant DNA
N/A
Software and Algorithms
Prism 8.0 GraphPad Software, Inc. N/A
Other
N/A