Neutralizing Antibodies Protect against Oral Transmission of Lymphocryptovirus

. 2020 Jun 23;1(3):100033. doi: 10.1016/j.xcrm.2020.100033

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

Recombinant AMMO1	Snijder et al.⁵⁵	N/A
Recombinant VRC01	Dr. John Mascola, NIAID Vaccine Research Center	N/A
CL40 with human constant regions	This study	N/A
CL59 with human constant regions	This study	N/A
72A1 with human constant regions	This study	N/A
hCD45-FITC	ThermoFisher	Cat # 11-9459-41;RRID:AB_1907395
mCD45-APC	ThermoFisher	Cat# 17-0451-82;RRID:AB_469392
hCD33-PE	BD Biosciences	Cat# 555450; RRID:AB_395843
hCD19-PE-Cy7	ThermoFisher	Cat# MHCD1912;RRID:AB_10373666
hCD4-eFluor450	ThermoFisher	Cat# 48-0048-42;RRID:AB_2016674
hCD8-PerCP-Cy5.5	BD Biosciences	Cat# 560662;RRID:AB_1727513
hCD38-PerCP-Cy5.5	BD Biosciences	Cat# 551400;RRID:AB_394184
hCD24-BV605	Biolegend	Cat# 311123; RRID:AB_2562287
hCD4-Alexafluor647	ThermoFisher	Cat# 56-0048-82;RRID:AB_657741
hCD137-BV421	BD Biosciences	Cat# 564091;RRID:AB_2722503
hCD69-BV605	Biolegend	Cat# 310937;RRID:AB_2562306
Goat Anti-Human IgG, Monkey ads-HRP	Southern Biotech	Cat# 2049-05; RRID:AB_2795696
hCD19- BV711	BioLegend	Cat# 302246;RRID:AB_2562065
hCD20-AF700	BioLegend	Cat# 302322;RRID:AB_493753
EBNA2-FITC	Novus Biologics	Cat# NBP2-50382F

Bacterial and Virus Strains

EBV B95.8/F	Delecluse et al.⁶⁷	N/A
Rhesus Lymphocryptovirus strain LCL 8664	From LCL 8664 Cell line, ATCC	CRL-1805

Biological Samples

human CD34-enriched PBSCs	Fred Hutch Co-operative Center for Excellence in Hematology	N/A

Chemicals, Peptides, and Recombinant Proteins

human recombinant thrombopoietin	PeproTech	Cat# 300-18
stem cell factor	PeproTech	Cat# 300-07
Flt3-Ligand	PeproTech	Cat# 300-19
busulfan	Otsuka America Pharmaceutical	Cat# 516968AA
mABSelect SuRe	Millipore Sigma	Cat# GE17-5438-01
Protein A Agarose	GoldBio	Cat# P-400-5
Pierce IgG Elution Buffer	ThermoFisher	Cat# 21009
sheared salmon sperm DNA	ThermoFisher	Cat# AM9680
rhLCV viral capsid antigen amino acids 117-146: AASAPAATP AVSSSISSLRAATSGAAASSA	Rao et al.⁶²	Custom synthesis Genscript
rhLCV viral capsid antigen amino acids 147-170: AVDTGSGG GAQPQDTSTRGARKKQ	Rao et al.⁶²	Custom synthesis Genscript
rhLCV viral capsid antigen amino acids 117-146 scramble: ISRP SLSAASSASAAAATGSSVASPTAAAA	This study	Custom synthesis Genscript
rhLCV viral capsid antigen amino acids147-170 scramble: VGGT SAKGQSKRDGARGTQAQPT	This study	Custom synthesis Genscript
HIV-1 Envelope protein 426c.NLGS.TM4.ΔV1-3	McGuire et al.⁷²	N/A
Dylite-650 NHS Ester	ThermoFisher	Cat# 62265
GeneJuice Transfection Reagent	EMD Millipore	Cat# 70967
12-O-Tetradecanoylphorbol 13-acetate	Sigma Aldrich	Cat# P8139
sodium butyrate	Sigma Aldrich	Cat# 303410
Cyclosporin A	Fisher Scientific	Cat# AAJ6319103
eBioscience Fixable Viability Dye eFluor 506	ThermoFisher	Cat# 65-0866-18

Critical Commercial Assays

DNeasy Blood & Tissue Kit	QIAGEN	Cat# 69504
Allprep DNA/RNA mini kit	QIAGEN	Cat# 80204
QiaAmp DNA blood mini kit	QIAGEN	Cat# 51104
QuantiTect Multiplex PCR Kit	QIAGEN	Cat# 204543
ddPCR Supermix for Probes, no-dUTP	Bio-Rad	Cat# 1863024
AluI restriction-enzyme	New England BioLabs	Cat# R0137S
Droplet Generator DG8 Cartridge	Bio-Rad	Cat# 1864008
SureBlue Reserve TMB Microwell Peroxidase substrate	SeraCare	Cat# 5120-0081
Steady-Glo luciferase reagent	Promega	Cat# E2510
Cell Line Nucleofector Kit V	Lonza	Cat# VVCA-1003
eBioscience Foxp3 / Transcription Factor Staining Buffer Set	ThermoFisher	Cat# 00-5523-00

Experimental Models: Cell Lines

Raji	ATCC	CCL-86
293E cells	National Research Council, Canada	N/A
Freestyle 293-F cells	Thermofisher	Cat# R79007
CHO-K1	ATCC	CCL-61
293-T7	Omerovic et al.⁷⁵	N/A
LCL 8664 cells	ATCC	CRL-1805
293T	ATCC	CRL-3216

Experimental Models: Organisms/Strains

NOD-scid Il2rg^null mice	The Jackson Laboratory	Stock No: 005557

Oligonucleotides

Forward primer specific for EBV BALF5 gene: CCCTGTTTATCC GATGGAATG	Kimura et al.⁷¹	N/A
Reverse primer specific for EBV BALF5 gene: CGGAAGCCCTC TGGACTTC	Kimura et al.⁷¹	N/A
FAM-labeled probe specific for EBV BALF5 gene: CGCATTTCTC GTGCGTGTACACC	Kimura et al.⁷¹	N/A
TaqMan Copy Number Reference Assay, human, RNase P	Thermofisher	Cat# 4403326
Rhesus LCV IR1 forward primer AAATCTAAACTTTTGAGGCG ATCTG	Sashihara et al.⁶³	N/A
Rhesus LCV IR1 reverse primer CCAACCATAGACCCGTTTCCT	Sashihara et al.⁶³	N/A
FAM-labeled Rhesus LCV IR1 probe TCTCCGCGTGCGCATAAT GGC	Sashihara et al.⁶³	N/A
Rhesus RPP30 forward primer GACTTGGACGTGCGAGCG	This study	N/A
Rhesus RPP30 reverse primer GCCGCTGTCTCCACAAGT	This study	N/A
Hex-labeled Rhesus RPP30 probe TCTGACCTGAAGGCTCTG CGCG	This study	N/A

Recombinant DNA

Double stranded BALF5 Target DNA for standard: ACCGAGACCCGGCAGGGGGTCCTGCGGTCGAAGGTGCTGG CCTTGAGGGCGCTGAGGACTGCAAACTCCACGTCCAGACCC TGAGGCGCGCTGGCGTAGAAGTAGGCCTGCTGCCCAAACAC GTTCACACACACGCTGGCCCCATCGGCCTTGCGCCGGCCCA GTAGCTTGATGACGATGCCACATGGCACCACATACCCCTGTT TATCCGATGGAATGACGGCGCATTTCTCGTGCGTGTACACCG TCTCGAGTATGTCGTAGACATGGAAGTCCAGAGGGCTTCCGT GGGTGTCTGCCTCCGGCCTTGCCGTGCCCTCTTGGGCACGC TGGCGCCACCACATGCCCTTTCCATCCTCGTCACCCCCCAC CACCGTCAGGGAGTCTTGGTAGAAGCACAGGGGGGGCTGAG GCCCCCGCACATCCACCACCCCTGCGGCGCCTGGTGTCTGG AAACACTTGGGAATGAGACGCAGGTACTCCTTGTCAGGCTTT TTC	This study	N/A
pCAGGS-rhLCVgH	Plate et al.⁷³	N/A
pCAGGS-rhLCVgL	Plate et al.⁷³	N/A
pCAGGS-rhLCVgB	Plate et al.⁷³	N/A
p509	Delecluse et al.⁶⁷	N/A
pT7EMCLuc	Okuma et al.⁷⁴	N/A

Software and Algorithms

QuantaSoft Analysis Software	Bio-Rad	N/A
Prism 7.03 or later software package	Graph Pad Software	N/A

Other

QuantStudio 7 Flex Real Time PCR System	Applied Biosystems	N/A
QX200 ddPCR System	Bio-Rad	N/A
C1000 Touch Thermal Cycler	Bio-Rad	N/A
QX200 Droplet Reader	Bio-Rad	N/A
SpectraMax M2 plate reader	Molecular Devices	N/A
BD LSRII cytometer	BD Biosciences	N/A
Ascent FL fluorimeter	Fluoroskan	N/A
EvosFL imaging system	ThermoFisher	N/A