Appendix 1—key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus, male) | NOD scid Gamma (M. musculus, male,) Mice | The Jackson Laboratory/Interbred at SAHMRI Bioresources | NOD.Cg-Prkdcscid/J RRID:IMSR_JAX:001303 |
|
| Cell line (Homo-sapiens) | LNCaP | ATCC | ATCC CRL-1740 RRID:CVCL_1379 |
|
| Cell line (Homo-sapiens) | VCaP | ATCC | ATCC CRL-2876 RRID:CVCL_2235 |
|
| Cell line (Homo-sapiens) | 22RV1 | ATCC | ATCC CRL-2505 RRID:CVCL_1045 |
|
| Cell line (Homo-sapiens) | PNT1A | The European Collection of Authenticated Cell Cultures (ECACC) | Cat# 95012614 RRID:CVCL_2163 |
|
| Cell line (Homo-sapiens) | PNT2 | The European Collection of Authenticated Cell Cultures (ECACC) | Cat# 95012613 RRID:CVCL_2164 |
|
| Cell line (Homo-sapiens) | V16D | PMID:27046225 | Kind gift from Prof. Amina Zoubeidi | |
| Cell line (Homo-sapiens) | MR49F | PMID:27046225 | Kind gift from Prof. Amina Zoubeidi | |
| Transfected construct (Homo sapiens) | control siRNA | Dharmacon | D-001810-01-20 ON-TARGET plus Non-targeting siRNA #1 | transfected construct (human) |
| Transfected construct (Homo sapiens) | siDECR1-1 | Dharmacon | J-009642-05-0002 | transfected construct (human) |
| Transfected construct (Homo sapiens) | siDECR1-2 | Dharmacon | J-009642-06-0002 | transfected construct (human) |
| Transfected construct (Homo sapiens) | DECR1 shRNA lentivector | GenTargrt |
LVS-1002 |
Lentiviral construct to transfect and express the shRNA. |
| Transfected construct (Homo sapiens) | hDECR1 Overexpressing Lentivector |
GenTargrt |
LVS-2002 |
Lentiviral construct to transfect and overexpress DECR1. |
| Transfected construct (Homo sapiens) | Negative control shRNA lentivector | GenTargrt |
LVS-1002 |
Lentiviral construct to transfect and express the shRNA. |
| Antibody | Anti-human β-Actin (Mouse monoclonal) | Sigma-Aldrich | Cat#: A5441 RRID:AB_476744 |
(WB 1:2000) |
| Antibody | Anti-human-HSP90 (Rabbit Polyclonal) |
Cell Signalling Technology | Cat#: 48745 RRID:CVCL_E547 |
(WB 1:1000) |
| Antibody | Anti-human DECR1 (Rabbit Polyclonal) | Prestige Antibodies (Sigma-Aldrich) | Cat#: HPA023238 RRID:AB_1847587 |
(WB 1:1000) (IHC: 1:500) |
| Antibody | Anti-human Malondialdehyde (Rabbit Polyclonal) |
Abcam | Cat#: ab6463 RRID:AB_305484 |
(WB 1:1000) |
| Antibody | Anti- human Androgen receptor (Rabbit Polyclonal) |
Santa Cruz Biotechnology | Cat#: sc-816 RRID:AB_1563391 |
(WB 1:1000) |
| Antibody | Anti-human PARP (Rabbit Polyclonal) |
Cell Signalling Technology | Cat#: 9542 RRID:AB_592473 |
(WB 1:1000) |
| Antibody | Anti-human Cytochrome C (Rabbit Polyclonal) |
Abcam | Cat#: ab90529 RRID:AB_10673869 |
(WB 1:2000) |
| Other | MitoTracker Red CMXRos | Thermo Fisher Scientific | Cat#: M7512 | ICC 1:1000 |
| Other | MitoSOX Red Mitochondrial Superoxide Indicator | Thermo Fisher Scientific | Cat#: M36008 | Flow Cytometry: 2.5 µM |
| Other | 3,3′-Diaminobenzidine (DAB) Enhanced Liquid Substrate System tetrahydrochloride | Sigma Aldrich | Cat#: D3939 | |
| Other | BODIPY-C11 | Thermo Fisher Scientific | Cat#: D3861 | Imaging: 5 µM |
| Antibody | Anti-human KI67 (Mouse monoclonal) |
DAKO | Cat#: M7240 RRID:AB_2142367 |
(IHC 1:200) |
| Antibody | Anti-human AR (Rabbit polyclonal) | Santa Cruz | Cat#: sc-816 RRID:AB_1563391 |
(WB 1:1000) |
| Sequence-based reagent | DECR1_F | This paper | PCR primers | CTAAATGGCACAGCCTTCGT |
| Sequenced-based reagent | DECR1_R | This paper | PCR primers | AACCTGAACCAGTCTCAGCA |
| Sequence-based reagent | GAPDH_F | This paper | PCR primers | TGCACCACCAACTGCTTAGC |
| Sequenced-based reagent | GAPDH_R | This paper | PCR primers | GGCATGGACTGTGGTCATGAG |
| Sequence-based reagent | PPIA_F | This paper | PCR primers | GCATACGGGTCCTGGCAT |
| Sequence-based reagent | PPIA_R | This paper | PCR primers | ACATGCTTGCCATCCAACC |
| Sequence-based reagent | TUBA1B _F | This paper | PCR primers | CCTTCGCCTCCTAATCCCTA |
| Sequence-based reagent | TUBA1B _R | This paper | PCR primers | CCGTGTTCCAGGCAGTAGA |
| Sequence-based reagent | MKI67_F | This paper | PCR primers | GCCTGCTCGACCCTACAGA |
| Sequence-based reagent | MIK67_R | This paper | PCR primers | GCTTGTCAACTGCGGTTGC |
| Sequence-based reagent | L19_F | This paper | PCR primers | TGCCAGTGGAAAAATCAGCCA |
| Sequence-based reagent | L19_R | This paper | PCR primers | CAAAGCAAATCTCGACACCTTG |
| Sequence-based reagent | GUSB_F | This paper | PCR primers | CGTCCCACCTAGAATCTGCT |
| Sequence-based reagent | GUSB_R | This paper | PCR primers | TTGCTCACAAAGGTCACAGG |
| Sequence-based reagent | DECR1_F | This paper | ChIP-qPCR | TTCTGGAGCGCTAAGAGAGC |
| Sequence-based reagent | DECR1_R | This paper | ChIP-qPCR | AGGGCTTCATCTGACAGTGG |
| Sequence-based reagent | KLK3_F | This paper | ChIP-qPCR | GCCTGGATCTGAGAGAGATATCATC |
| Sequence-based reagent | KLK3_R | This paper | ChIP-qPCR | ACACCTTTTTTTTTCTGGATTGTTG |
| Sequence-based reagent | NC2_F | This paper | ChIP-qPCR | GTGAGTGCCCAGTTAGAGCATCTA |
| Sequence-based reagent | NC2_R | This paper | ChIP-qPCR | GGAACCAGTGGGTCTTGAAGTG |
| Chemical compound, drug | Etomoxir | Sigma Aldrich | Cat#: E1905 | |
| Chemical compound, drug | Dihydrotestosterone | Sigma Aldrich |
Cas#: 521-18-6 |
|
| Chemical compound, drug | Enzalutamide | Sapphire Bioscience | Cat#: S1250 | |
| Chemical compound, drug | Bovine-serum albumin | Bovostar | Cat#: BSAS-AU | |
| Chemical compound, drug | Linoleic acid | Sigma Aldrich | Cat#: L1376 | |
| Chemical compound, drug | Palmitic acid | Sigma Aldrich | Cat#: P0500 | |
| Chemical compound, drug | D-Luciferin | PerkinElmer | Cat#: 122799 | 3 mg/20 g |
| Chemical compound, drug | Deferoxamine | Sigma Aldrich | Cat#: D9533 | |
| Chemical compound, drug | Ferrostatin | Sigma Aldrich | Cat#: SML0583 | |
| Chemical compound, drug | Erastian | Sigma Aldrich | Cat#: E7781 | |
| Chemical compound, drug | ML210 | Tocris Bioscience | Cat#: 6429 | |
| Chemical compound, drug | FIN56 | Tocris Bioscience | Cat#: 6280 | |
| Chemical compound, drug | cell fractionation kit | Abcam | Cat#: ab109719 | |
| Chemical compound, drug | RNeasy RNA extraction kit | Qiagen | Cat#: 74136 | |
| Chemical compound, drug | iScript cDNA Synthesis kit | Bio-Rad | Cat#: 1708890 | |
| Chemical compound, drug | Seahorse XF Cell Mitochondrial Stress Test kit | Agilent | Cat#: 103015–100 | |
| Software, algorithm | GraphPad Prism | GraphPad Software, Inc | Prism V7 RRID:SCR_002798 |
|
| Software, algorithm | R | R Development Core Team, 2019 | R version 3.6.2 RRID:SCR_001905 |
|
| Software, algorithm | ReViSP | PMID:25561413 | ReViSP | Volume assessment of cancer spheroids |
| Software, algorithm | IVIS Spectrum In Vivo Imaging System | PerkinElmer | IVIS Spectrum In Vivo Imaging System RRID:SCR_018621 |
Tumor volume analysis |
| Other | Lipofectamine RNAiMAX transfection reagent | Thermo Fisher Scientific | 13778075 | |
| Software, algorithm | ImageJ analysis software | NIH | ImageJ RRID:SCR_003070 |
|
| Software, algorithm | TraceFinder v5.0 | Thermo Fisher Scientific | OPTON-30688 |