Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | E. coli BL21 strain expressing pGEX2T-1-GST-RBD | This paper, 10.1038/s41467-017-01019-z | To purify GST-RBD for Ras-GTP assays | |
| Strain, strain background (Saccharomyces cerevisiae) | wt control | 10.1016/j.cell.2016.05.006 | YMM130 | MAT alpha his3Δ1::pRS403, leu2Δ0 lys2Δ0 ura3Δ0 |
| Strain, strain background (Saccharomyces cerevisiae) | o/e TSA1 | 10.1016/j.cell.2016.05.006 | o/e TSA1 | MAT alpha his3Δ1::pRS403-Myc-TSA1, leu2Δ0 lys2Δ0 ura3Δ0 |
| Strain, strain background (Saccharomyces cerevisiae) | pde2Δ control | This paper | YMM175 | MAT alpha his3Δ1::pRS403, leu2Δ0 lys2Δ0 ura3Δ0 pde2Δ::kanMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | pde2Δ o/e TSA1 | This paper | YMM176 | MAT alpha his3Δ1::pRS403-Myc-TSA1, leu2Δ0 lys2Δ0 ura3Δ0 pde2Δ::kanMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | wt | 10.1002/(SICI)1097-0061(19980130)14:2<115::AID-YEA204>3.0.CO;2–2. | BY4742 | MAT alpha his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 |
| Strain, strain background (Saccharomyces cerevisiae) | tsa1Δ | 10.1016/j.molcel.2011.07.027 | YMM114 | BY4742 tsa1Δ::natMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | ras2Δ | 10.1016/j.molcel.2011.07.027 | YMM113 | BY4742 ras2Δ::kanMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | ras2Δtsa1Δ | This paper | YMM170 | BY4742 ras2Δ::kanMX4 tsa1Δ::natMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | pde2Δ | Research Genetics, 10.1038/nature00935. | pde2Δ | BY4742 pde2Δ::kanMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | ras2Δpde2Δ | This paper | YMM171 | BY4742 ras2Δ::kanMX4 pde2Δ::hphMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | pde2Δtsa1Δ | This paper | YMM172 | BY4742 pde2Δ::kanMX4 tsa1Δ::natMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | ras2Δpde2Δtsa1Δ | This paper | YMM173 | BY4742 ras2Δ::kanMX4 pde2Δ::hphMX4 tsa1Δ::natMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | tsa1C48S | 10.1038/ncomms14791 | YMM145 | BY4742 tsa1C48S |
| Strain, strain background (Saccharomyces cerevisiae) | tsa1C171S | 10.1038/ncomms14791 | YMM146 | BY4742 tsa1C171S |
| Strain, strain background (Saccharomyces cerevisiae) | tsa1ΔYF | 10.1038/ncomms14791 | YMM147 | BY4742 tsa1(1-184) |
| Strain, strain background (Saccharomyces cerevisiae) | tsa1C171SΔYF | 10.1038/ncomms14791 | YMM148 | BY4742 tsa1(1-184)C171S |
| Strain, strain background (Saccharomyces cerevisiae) | trx1Δtrx2Δ | 10.1038/ncomms14791 | YMM143 | BY4742 trx1Δ::hphMX4 trx2Δ::natMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | msn2Δmsn4Δ | This paper | YMM174 | BY4742 msn2Δ::hphMX4 msn4Δ::natMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | ras1Δ::hphMX4 | This paper | YMM177 | MAT a, his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 ras1Δ::hphMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | This paper | YMM178 | BY-2n met15Δ0/MET15 lys2Δ0/LYS2 tpk1Δ::kanMX4/TPK1 tpk2Δ::natMX4/TPK2 tpk3Δ::hphMX4/TPK3 | |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk3Δ | This paper | YMM179 | BY4742 tpk1Δ::kanMX4 tpk3Δ::hphMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk2Δtpk3Δ | This paper | YMM180 | BY4742 tpk2Δ::natMX4 tpk3Δ::hphMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ pTPK1-URA | This paper | YMM181 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-TPK1 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ pTPK1-URA vector control | This paper | YMM182 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313 pTPK1-URA3 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ pTPK1-URA pTPK1 | This paper | YMM183 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-TPK1 pTPK1-URA3 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ pTPK1-URA3 ptpk1C243A | This paper | YMM184 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1C243A pTPK1-URA3 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ pTPK1-URA3 ptpk1C243D | This paper | YMM185 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1C243D pTPK1-URA3 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ pTPK1-URA3 ptpk1T241A | This paper | YMM186 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1T241A pTPK1-URA3 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ pTPK1 | This paper | YMM187 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-TPK1 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ ptpk1C243A | This paper | YMM188 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1C243A |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ ptpk1C243D | This paper | YMM189 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1C243D |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ ptpk1T241A | This paper | YMM190 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1T241A |
| Strain, strain background (Saccharomyces cerevisiae) | ras2Δtrx1Δtrx2Δ | This paper | YMM191 | BY4742 ras2Δ::kanMX4 trx1Δ::hphMX4 trx2Δ::natMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | tsa1Δ::bleMX4 | This paper | YMM192 | BY4741 tsa1Δ::bleMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk2Δtpk3Δtsa1Δ | This paper | YMM193 | BY4741 tpk2Δ::natMX4 tpk3Δ::hphMX4 tsa1Δ::bleMX4 |
| Strain, strain background (Saccharomyces
cerevisiae) |
TPK1-HBH tpk2Δtpk3Δ | This paper | WR1832 | BY4742 TPK1-HBH::TRP1 tpk2Δ::natMX4 tpk3Δ::hphMX4 trp1Δ::kanMX4 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ pTPK1-URA vector control | This paper | yCP101 | MAT a his3Δ1::pRS403, leu2Δ0 lys2Δ0 ura3Δ0 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-TPK1 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ ptpk1C243A-URA vector control | This paper | yCP102 | MAT alpha his3Δ1::pRS403, leu2Δ0 lys2Δ0 ura3Δ0 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-tpk1C243A |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ pTPK1-URA o/e TSA1 | This paper | yCP103 | MAT alpha his3Δ1::pRS403-myc-TSA1, leu2Δ0 lys2Δ0 ura3Δ0 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-TPK1 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δ ptpk1C243A-URA o/e TSA1 | This paper | yCP104 | MAT alpha his3Δ1::pRS403-myc-TSA1, leu2Δ0 lys2Δ0 ura3Δ0 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-tpk1C243A |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δtsa1Δ pTPK1 | This paper | yCP105 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 tsa1Δ::bleMX4 pRS313-TPK1 |
| Strain, strain background (Saccharomyces cerevisiae) | tpk1Δtpk2Δtpk3Δtsa1Δ ptpk1T241A | This paper | yCP106 | BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 tsa1Δ::bleMX4 pRS313-tpk1T241A |
| Strain, strain background (Saccharomyces cerevisiae) | TPK1-HBH tpk2Δtpk3Δtsa1Δ | This paper | yCP107 | BY4742 TPK1-HBH::TRP1 tpk2Δ::natMX4 tpk3Δ::hphMX4 tsa1Δ::bleMX4 trp1Δ::kanMX4 tsa1Δ::bleMX4 |
| Antibody | (mouse monoclonal) anti-Tpk1 | Santa Cruz Biotechnology | Sc-374592, RRID:AB_10990730 | (1:1000) |
| Antibody | (goat polyclonal) anti-Bcy1 | Santa Cruz Biotechnology | Sc-6734, RRID:AB_671758 | (1:2000) |
| Antibody | (rabbit) IgG; anti-Protein A | Sigma Aldrich | I5006, RRID:AB_1163659 | 1 μg/ml |
| Antibody | (goat polyclonal) anti-Ras2 | Santa Cruz Biotechnology | Sc-6759, RRID:AB_672465 | (1:2000) |
| Antibody | (mouse monoclonal) anti-Glutathione (D8) | Abcam | ab19534, RRID:AB_880243 | (1:1000) |
| Antibody | (mouse monoclonal) anti-Pgk1 (22C5D8) | Thermo Fisher | 459250, RRID:AB_2532235 | (1:500) |
| Antibody | (mouse monoclonal) anti-2 Cys Prx (6E5); (anti-Tsa1) | Abcam | ab16765, RRID:AB_443456 | (1:1000) |
| Recombinant DNA reagent | yEP24 | 10.1016/0378-1119(79)90004-0 | yeast 2μ, URA3 vector plasmid | |
| Recombinant DNA reagent | pKF56 | 10.1128/mcb.10.8.4303. | IRA2 in yEP24 | |
| Recombinant DNA reagent | pRS425 | 10.1016/0378-1119(92)90454w. | yeast 2μ, LEU2 vector plasmid | |
| Recombinant DNA reagent | yEP13-PDE2 | 10.1093/emboj/cdg314. | PDE2 in yeast 2μ, LEU2 plasmid | |
| Recombinant DNA reagent | yEPlac195 | 10.1016/0378-1119(88)90185-0. | yeast 2μ, URA3 vector plasmid | |
| Recombinant DNA reagent | pXP1 | 10.1128/mcb.19.7.4874. | BCY1 in yEPlac195 | |
| Recombinant DNA reagent | pRS315 | PMID:2659436 | yeast CEN/ARS, LEU2 empty vector plasmid | |
| Recombinant DNA reagent | B561 (pRS315-RAS2G19V) | 10.1128/mcb.19.10.6775. | RAS2G19V in pRS315 | |
| Recombinant DNA reagent | pHyPer3C199S (pRS416-GPD-HyPer3C199S) | This paper, 10.1021/cb300625g | HyPer3C199S | |
| Recombinant DNA reagent | pRS416-GPD-AKAR4 | Molin et al., 2020 | AKAR4 in pRS416-GPD [CEN/ARS, pGPD promotor, URA3] | |
| Recombinant DNA reagent | pRS316 | PMID:2659436 | yeast CEN/ARS, URA3 empty vector plasmid | |
| Recombinant DNA reagent | pRS316- myc-TSA1 | 10.1038/nature02075. | Myc-TSA1 in pRS316 | |
| Recombinant DNA reagent | pRS316- myc-tsa1C48S | 10.1016/j.molcel.2011.07.027 | Myc-tsa1C48S in pRS316 | |
| Recombinant DNA reagent | pRS316- myc-tsa1C171S | 10.1016/j.molcel.2011.07.027 | Myc-tsa1C171S in pRS316 | |
| Recombinant DNA reagent | pRS315-ProtA | This paper | ProteinA in pRS315 | |
| Recombinant DNA reagent | pRS315-TRX2-ProteinA | 10.1038/ncomms14791 | TRX2-ProtA in pRS315 | |
| Recombinant DNA reagent | pRS315-trx2C34S-ProteinA | This paper | trx2C34S-ProtA in pRS315 | |
| Recombinant DNA reagent | pRS315-trx2C31SC34S-ProteinA | This paper | trx2C31SC34S-ProtA in pRS315 | trx2C31SC34S-ProtA in pRS315 |
| Recombinant DNA reagent | pRS313 | PMID:2659436 | yeast CEN/ARS, HIS3 empty vector | yeast CEN/ARS, HIS3 empty vector |
| Recombinant DNA reagent | pRS313-TPK1 | 10.1074/jbc.M110.200071. | TPK1 in pRS313 | TPK1 in pRS313 |
| Recombinant DNA reagent | pRS313-tpk1C243A | This paper | tpk1C243A in pRS313 | tpk1C243A in pRS313 |
| Recombinant DNA reagent | pRS313-tpk1C243D | This paper | tpk1C243D in pRS313 | tpk1C243D in pRS313 |
| Recombinant DNA reagent | pRS313-tpk1T241A | This paper | tpk1T241A in pRS313 | tpk1T241A in pRS313 |
| Recombinant DNA reagent | pTPK1-URA3 (pRS316-TPK1) | Karin Voordeckers | TPK1 in pRS316 | TPK1 in pRS316 |
| Recombinant DNA reagent | ptpk1C243A-URA3 | This paper | tpk1C243A in pRS316 | tpk1C243A in pRS316 |
| Sequence-based reagent | ACT1F | 10.1016/j.molcel.2011.03.021 | For Q-PCR of ACT1 | CTGCCGGTATTGACCAAACT |
| Sequence-based reagent | ACT1R | 10.1016/j.molcel.2011.03.021 | For Q-PCR of ACT1 | CGGTGAATTTCCTTTTGCATT |
| Sequence-based reagent | CTT1F | This paper | For Q-PCR of CTT1 | GCTTCTCAATACTCAAGACCAG |
| Sequence-based reagent | CTT1R | This paper | For Q-PCR of CTT1 | GCGGCGTATGTAATATCACTC |
| Sequence-based reagent | HSP12F | 10.1016/j.molcel.2011.03.021 | For Q-PCR of HSP12 | AGGTCGCTGGTAAGGTTC |
| Sequence-based reagent | HSP12R | 10.1016/j.molcel.2011.03.021 | For Q-PCR of HSP12 | ATCGTTCAACTTGGACTTGG |
| Peptide, recombinant protein | Glutathione-S-Transferase-Raf1-Binding-Domain (GST-RBD) | This paper, 10.1038/s41467-017-01019-z | For Ras-GTP assay | Purified from E. coli strain BL21 expressing pGEX2T-1-GST-RBD |
| Commercial assay or kit | PureLink RNA Mini kit | Thermo-Fisher | Cat #: 12183025 | |
| Commercial assay or kit | QuantiTect Reverse Transcription Kit | Qiagen | Cat #: 205313 | |
| Commercial assay or kit | iQ SYBR Green Supermix | BioRad | Cat #: 170–8882 | |
| Commercial assay or kit | LANCE cAMP 384 kit | Perkin Elmer | Cat #: AD0262 | |
| Chemical compound, drug | G418 | Acros Organics | Cat #: 329400050 | |
| Chemical compound, drug | ClonNAT | Werner Bioagents | Cat #: 5.005.000 | |
| Chemical compound, drug | Hygromycin B | Formedium | Cat #: HYG5000 | |
| Chemical compound, drug | Phleomycin | Sigma Aldrich | P9564 | |
| Chemical compound, drug | 5-fluoroorotic acid | Sigma Aldrich | F5013 | |
| Chemical compound, drug | EZ-Link Sulfo-NHS-LC Biotin | Thermo Fisher | Cat #: 21335 | |
| Chemical compound, drug | Trichloroacetic acid | Sigma Aldrich | Cat #: T6399 | |
| Chemical compound, drug | KSCN | Sigma Aldrich | Cat #: P2713 | |
| Chemical compound, drug | (NH4)2Fe(SO4)2 • 6 H2O | Sigma Aldrich | Cat #: 215406 | |
| Chemical compound, drug | TRIzol Reagent | Thermo Fisher | Cat #: 15596026 | |
| Chemical compound, drug | DNase, RNase-free set | Qiagen | Cat #: 79254 | |
| Chemical compound, drug | cOmplete Mini EDTA-free protease inhibitor | Roche Applied Science | Cat #: 11873580001 | |
| Chemical compound, drug | Glutathione Sepharose beads | GE Healthcare | Cat #: 17-0756-01 | |
| Chemical compound, drug | 12% Bis-Tris NUPAGE gels | Thermo FisherArch Biochem Biophys | Cat #: NP0349BOX | |
| Chemical compound, drug | MOPS running buffer | Thermo Fisher | Cat #: NP0001 | |
| Chemical compound, drug | Immobilon-FL PVDF membrane | Millipore | Cat #: IPFL00010 | |
| Chemical compound, drug | Ni2+-Sepharose beads | GE Healthcare | Cat #: 17-5318-06 | |
| Chemical compound, drug | Anti-c-myc, agarose conjugated | Sigma-Aldrich | Cat #: A7470 | |
| Chemical compound, drug | Trypsin Gold, mass spectrometry grade | Promega | Cat #: V5280 | |
| Chemical compound, drug | N-ethylmaleimide | Sigma-Aldrich | Cat #: E3876 | |
| Chemical compound, drug | DYn-2 | Cayman Chemical | Cat #: 11220 | |
| Chemical compound, drug | 10% Criterion TGX Precast Midi Protein Gel | Bio-Rad | Cat #: 5671034 | |
| Chemical compound, drug | Peptide Retention Time Calibration Mixture | Pierce, Thermo Fisher | Cat #: 88320 | |
| Software, algorithm | MATLAB | Mathworks | version 2016b | |
| Software, algorithm | CellX | 10.1002/0471142727.mb1422s101 | ||
| Software, algorithm | Scrödinger Suite | Schrödinger LLC | ||
| Software, algorithm | GROMACS | 10.1016/j.softx.2015.06.001 | ||
| Software, algorithm | Amber tools | 10.1002/wcms.1121 |