Table 1.
Hair qRT-PCR primers
| Gene | Forward primer (5′ to 3′) | Reverse primer (5′ to 3′) |
|---|---|---|
| Versican | tgagcatgacttccgttggactga | ccactggccattctcatgccaaat |
| α-SMA | gtttgagaccttcaatgtccc | cgatctcacgctcagcagtga |
| ALP | caacagggtagatttctcttgg | ggtcagatccagaatgttcc |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.