Appendix 1—key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (D. melanogaster) | Pngl | GenBank | FLYB:FBgn0033050 | |
| Gene (Mus musculus) | Ngly1 | GenBank | Gene ID: 59007 | |
| Gene (Homo sapiens) | NGLY1 | GenBank | Gene ID: 55768 | |
| Strain, strain background (Escherichia coli) | TOP10. Genotype: F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(araleu)7697 galU galK rpsL (StrR) endA1 nupG |
Life Technologies | C404010 | Chemically Competent Cells |
| Genetic reagent (D. melanogaster) | Mef2-GAL4 | Bloomington Drosophila Stock Center | BDSC: 27390; FLYB: FBti0115746 | FlyBase symbol: P{GAL4-Mef2.R}3 |
| Genetic reagent (D. melanogaster) | UAS-dpp-GFP | Bloomington Drosophila Stock Center | BDSC: 53716; FLYB: FBti0157003 | FlyBase symbol: P{UAS-dpp.GFP.T}3 |
| Genetic reagent (D. melanogaster) | dpp-GAL4 | Bloomington Drosophila Stock Center | BDSC: 1553; FLYB: FBti0002123 | FlyBase symbol: P{GAL4-dpp.blk1}40C.6 |
| Genetic reagent (D. melanogaster) | Mi{[MIC]}dppMI03752 | Bloomington Drosophila Stock Center | BDSC: 36399; FLYB: FBti0145223 | FlyBase symbol: Mi{MIC}dppMI03752 |
| Genetic reagent (D. melanogaster) | PBac{[RB]} | Exelixis at Harvard Medical School | FLYB:e00178 FBti0046265 |
FlyBase symbol: PBac{RB}e00178 |
| Genetic reagent (D. melanogaster) | Pnglex14 | Funakoshi et al., 2010 | FLYB: FBal0244826 | FlyBase symbol: Pnglex14 |
| Genetic reagent (D. melanogaster) | UAS-PnglRNAiKK101641 | Vienna Drosophila Resource Center | VDRC: v103607 FLYB: FBst0475465 |
FlyBase symbol: P{KK101641}VIE-260B |
| Genetic reagent (D. melanogaster) | UAS-attB-NGLY1WT-VK31 | Galeone et al., 2017 | Fly strain carrying human UAS-cDNA of wild-type NGLY1 | |
| Genetic reagent (D. melanogaster) | UAS-attB-NGLY1N41P-VK31 | This paper | Fly strain carrying human UAS-cDNA of NGLY1 with mutation in VCP binding site | |
| Genetic reagent (D. melanogaster) | UAS-attB-NGLY1F70A/G80A-VK31 | This paper | Fly strain carrying human UAS-cDNA of NGLY1 with mutation in VCP binding site | |
| Genetic reagent (D. melanogaster) | dppHA | This paper | Fly strain carrying endogenous HA-tag of dpp active domain | |
| Genetic reagent (D. melanogaster) | dppHA-3NQ | This paper | Fly strain carrying endogenous HA-tag of dpp active domain and N to Q mutations in N-glycosylation sites | |
| Strain, strain background Mus musculus | Ngly1em4Lutzy kept on a C57BL/6J background | The Jackson Laboratory | Stock #027060 | Mouse strain carrying an 11 bp deletion in exon 8 of the mouse Ngly1 |
| Cell line (Mus musculus) | Mouse Embryonic Fibroblast (MEF) cells | Huang et al., 2015 | Established from C57BL/6J background |
|
| Cell line (Mus musculus) |
3T3-L1 cells | American Type Culture Collection | ATCC, CL-173 | From Dr. Sandhya Thomas |
| Recombinant DNA reagent | Human NGLY1 cDNA in pCMV6-AC (plasmid) | OriGene | clone SC320763 | Human untagged cloning vector |
| Recombinant DNA reagent | pIRES-DsRed2-Express2 | Clontech | Cat# 632540 | Expressing vector backbone construct |
| Transfected construct (Homo sapiens) | pIRES-NGLY1WT-V5-His6-DsRED | This paper | transfected NGLY1 construct (human) | |
| Transfected construct (Homo sapiens) | pIRES-NGLY1N41P-V5-His6-DsRED | This paper | transfected NGLY1 construct (human) | |
| Transfected construct (Homo sapiens) | pIRES-NGLY1 G79A/F80A-V5-His6-DsRED | This paper | transfected NGLY1 construct (human) | |
| Transfected construct (Homo sapiens) | pCS2+Bmp4HA-Myc | Gift from Dr. Jan Christian | mouse BMP4 protein (NP_031580) | Double-tagged mouse BMP4 construct |
| Transfected construct (Homo sapiens) | pCS2+Bmp4HA-Myc-4NQ | This paper | mouse BMP4 protein (NP_031580) | Double-tagged mouse BMP4 construct with N to Q mutations in N-glycosylation sites |
| Transfected construct (Homo sapiens) | pUAST-attB-NGLY1WT | This paper | Fly expressing vector carrying human UAS-cDNA of wild-type NGLY1 | |
| Transfected construct (Homo sapiens) | pUAST-attB-NGLY N41P | This paper | Fly expressing vector carrying human UAS-cDNA of wild-type NGLY1 with mutation in VCP binding site | |
| Transfected construct (Homo sapiens) | pUAST-attB-NGLY F70A/G80A | This paper | Fly expressing vector carrying human UAS-cDNA of wild-type NGLY1 with mutation in VCP binding site | |
| Antibody | anti-HA (Rat monoclonal) |
Roche | Cat# 11867423001 RRID:AB_390918 | IF (1:250) |
| Antibody | anti- pSMAD3 (Rabbit monoclonal) |
Abcam | Cat# ab52903 RRID:AB_882596 | IF (1:250) |
| Antibody | anti-NGLY1 (Rabbit polyclonal) |
Sigma-Aldrich | Cat# HPA036825 RRID:AB_10672231 | IF (1:200) |
| Antibody | anti-GFP (Mouse monoclonal) | Sigma-Aldrich | Cat# G1546 RRID:AB_1079024 | WB (1:1000) |
| Antibody | anti-pSMAD1/5 (Rabbit monoclonal) | Cell Signaling | Cat# 9516 RRID:AB_491015 | IF (1:500) WB (1:500) |
| Antibody | anti-HA (Mouse monoclonal) | Sigma-Aldrich | Cat# SAB2702217 RRID:AB_2750919 | IF(1:500) WB (1:1000) |
| Antibody | anti-myc (Mouse monoclonal) | Cell Signaling | Cat# 2276 RRID:AB_331783 | WB (1:500) |
| Antibody | Anti-FK1(Mouse monoclonal) | Sigma-Aldrich | Cat# 04–262 RRID:AB_612094 | WB (1:500) |
| Antibody | anti-KDEL (Mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-58774 RRID:AB_784161 |
WB (1:500) |
| Antibody | anti-VCP (Mouse Polyclonal) | Santa Cruz Biotechnology | Cat# sc-20799 RRID:AB_793930 |
WB (1:500) |
| Antibody | anti-IRE1α (Rabbit monoclonal) | Cell Signaling | Cat# 3294 RRID:AB_823545 |
WB (1:1000) |
| Antibody | anti-pIRE1α (Rabbit polyclonal) | Novus Biologicals | Cat# 100–2323 RRID:AB_10145203 |
WB (1:1000) |
| Antibody | anti-OS-9 (Rabbit monoclonal) | Abcam | Cat# ab109510 RRID:AB_2848681 |
WB (1:1000) |
| Antibody | anti-V5 (Mouse monoclonal) | FUJIFILM Wako Pure Chemical Corporation | Cat# 4548995010711 | WB (1:1000) |
| Sequence-based reagent | hNG1-N41P-for | This paper | PCR primers | CTCACCTATGCTGACCCCATCCTCAGAAACCC |
| Sequence-based reagent | hNG1-N41P-rev | This paper | PCR primers | GGGTTTCTGAGGATGGGGTCAGCATAGGTGA |
| Sequence-based reagent | hNG1-G79F80-for | This paper | PCR primers | GTTTATTTGAAATGGCCGCTGAAGAGGGAGAAAC |
| Sequence-based reagent | hNG1-G79F80-rev | This paper | PCR primers | GTTTCTCCCTCTTCAGCGGCCATTTCAAATAAAC |
| Sequence-based reagent | pIRES-EcoRI-huNGLY1-F | This paper | PCR primers | CTCAAGCTTCGAATTCTCAAGCATGGCGGCGGCG |
| Sequence-based reagent | v5His6-tga-SalI-pIRES-R | This paper | PCR primers | CCGCGGTACCGTCGACTCAATGGTGATGGTGGTGATGCGTAGAATCGAGACCGAG |
| Sequence-based reagent | NGLY1-N41P-F | This paper | PCR primers | ATTAGGGTTTCTGAGGATGGGGTCAGCATAGGTGAGCAGC |
| Sequence-based reagent | NGLY1-N41P-R | This paper | PCR primers | GCTGCTCACCTATGCTGACCCCATCCTCAGAAACCCTAAT |
| Sequence-based reagent | NGLY1-G79A_F80A-F | This paper | PCR primers | GATGAGATGTGTTTCTCCCTCTTCAGCGGCCATTTCAAATAAACATTCAACAGC |
| Sequence-based reagent | NGLY1-G79A_F80A-R | This paper | PCR primers | GCTGTTGAATGTTTATTTGAAATGGCCGCTGAAGAGGGAGAAACACATCTCATC |
| Sequence-based reagent | m-Psmb1-F | Yang et al., 2018 | PCR primers | CCTTCAACGGAGGTACTGTATTG |
| Sequence-based reagent | m-Psmb1-R | Yang et al., 2018 | PCR primers | GGGCTATCTCGGGTATGAATTG |
| Sequence-based reagent | m-Psmb4-F | Yang et al., 2018 | PCR primers | CGAGTCAACGACAGCACTAT |
| Sequence-based reagent | m-Psmb4-R | Yang et al., 2018 | PCR primers | ATCTCCCAACAGCTCTTCATC |
| Sequence-based reagent | m-Psma7-F | Yang et al., 2018 | PCR primers | CGAGTCTGAAGCAGCGTTAT |
| Sequence-based reagent | m-Psma7-R | Yang et al., 2018 | PCR primers | AGTCTGATAGAGTCTGGGAGTG |
| Peptide, recombinant protein | Recombinant Human BMP-4 Protein |
R and D Systems | Cat# 314 BP | |
| Commercial assay or kit | In-Fusion HD Cloning | TaKaRa | Cat# 638920 | |
| Commercial assay or kit | Site-Directed Mutagenesis Kit |
Agilent Technologies | Cat# 200523 | |
| Commercial assay or kit | ENDEXTTechnology, Protein Research Kit (H) | Cell Free Science | CFS-PRK-H16 | |
| Commercial assay or kit | HA-tag IP/Co-IP kit | PIERCE | Cat# 26180 | |
| Chemical compound, drug | NMS-873 | Sigma-Aldrich | Cat# 5310880001 | |
| Chemical compound, drug | Bortezomib | Cayman Chemical | Cat# 10008822 | |
| Software, algorithm | GraphPad Prism | Prism | RRID:SCR_002798 |