KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-Lactoylglutathione lyase | MilliporeSigma | Cat# 05-1925 |
| Rabbit polyclonal HAGH | ThermoFisher | Cat# PA5-28292 |
| Rabbit monoclonal HK1 | Cell Signaling Technologies | Cat# 2024 |
| Rabbit monoclonal LDHA | Cell Signaling Technologies | Cat# 3582 |
| Rabbit monoclonal PKM1/2 | Cell Signaling Technologies | Cat# 3190 |
| Rabbit monoclonal ALDOA | Cell Signaling Technologies | Cat# 8060 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Human recombinant PGK1 | BioVision | Cat# 7819 |
| alkMethylglyoxal | Sibbersen et al., 2013 | N/A |
| Methylglyoxal | MP Biomedicals | Cat# 02155558-CF; CAS: 78-98-8 |
| Histone H4 | New England Biolabs | Cat# M2504S |
| GSH-(glycine-l3C2,l5N, internal standard) | MilliporeSigma | Cat# 683620 |
| (1-Carboxyethyl)-L-lysine-d4 | Toronto Research Chemicals | Cat# C178072 |
| Deposited Data | ||
| homo sapiens protein database, SwissProt (Nov 5 2018, 42252 sequences) | ftp://ftp.thegpm.org/fasta/cRAP | N/A |
| Experimental Models: Cell Lines | ||
| HEK293 GLO1−/− | Galligan et al., 2018 | N/A |
| Experimental Models: Organisms/Strains | ||
| Mouse: C57BL/6J | Vanderbilt University | Cat# 5656552, RRID:MGI:5656552 |
| Oligonucleotides | ||
| GLO2 gRNA targeting sequence: TACGGGGGTGACGACCGTAT | This paper | N/A |
| Primer: GLO2 Forward: CCACTGCACCAGGACAAGAAATCCACC | This paper | N/A |
| Primer: GLO2 Reverse: GGCTGAAGACACCCTCGCAGGG | This paper | N/A |
| Recombinant DNA | ||
| Plasmid: pSpCas9(BB)-2A-Puro | Cong et al., 2015 | N/A |
| Deposited Data | ||
| Proteomics data set of lactoylated proteins | Mendeley Data | DOI:10.17632/9ccms3gnf6.2 |
| Software and Algorithms | ||
| Xcalibur v 4.0.27.19 | Andon et al., 2002 | https://www.thermofisher.com/order/catalog/product/OPTON-30965 |
| Scaffold Q+S v 4.8.7 | Proteome Software Inc., Portland OR | http://www.proteomesoftware.com/products/scaffold/ |
| Other | ||
| Kintetix C8 column | Phenomenex | |
| 50 x 2.1mm, 3mm particle diameter Ascentis C18 column | Supelco | Cat# SU581300-U |
| 150 x 2.1mm, 3.5 μm particle diameter Eclipse XDB-C8 column | Agilent, Santa Clara, CA | Cat# 930990-906 |
| 2.1 mm x 100 mm, 3.5 μm particle diameter XBridge Amide column | Waters, Milford, MA | Cat# 186004860 |
| Acclaim Pepmap 100 trap column, 75 micron ID x 25 cm | ThermoScientific | Cat# 164569 |