Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Saccharomyces cerevisiae) | YDR125 | This paper | Overexpression and purification of FACT (see Table 1) |
|
| Strain, strain background (Saccharomyces cerevisiae) | YJF38 | PMID:23474987 | Overexpression and purification of Cdt1·Mcm2-7WT | |
| Strain, strain background (Saccharomyces cerevisiae) | YMC5 | PMID:24566988 | Overexpression and purification of DDK | |
| Strain, strain background (Saccharomyces cerevisiae) | YSA11 | This paper | Overexpression and purification of Cdt1·Mcm2-72-TEV (see Table 1) | |
| Strain, strain background (Saccharomyces cerevisiae) | YSA27 | This paper | Overexpression and purification of Cdt1·Mcm2-72-2A (see Table 1) | |
| Strain, strain background (Saccharomyces cerevisiae) | YSA35 | This paper | Overexpression and purification of DDK (see Table 1) |
|
| Antibody | Anti-Cdc7 (yN-18) (goat polyclonal) | Santa Cruz Biotechnology | Cat. #: sc-11964 RRID:AB_638349 |
(1:2000) |
| Antibody | Anti-Dbf4 (yA-16) (goat polyclonal) | Santa Cruz Biotechnology | Cat. #: sc-5706 RRID:AB_637654 |
(1:2000) |
| Antibody | Anti-Mcm2 (yN-19) (goat polyclonal) | Santa Cruz Biotechnology | Cat. #: sc-6680 RRID:AB_648843 |
(1:2000) |
| Antibody | Anti-Mcm4 (yC-19) (goat polyclonal) | Santa Cruz Biotechnology | Cat. #: sc-6685 RRID:AB_648862 |
(1:2000) |
| Antibody | Anti-Mcm5 (yN-19) (goat polyclonal) | Santa Cruz Biotechnology | Cat. #: sc-6687 RRID:AB_648872 |
(1:2000) |
| Antibody | Anti-Mcm7 (yN-19) (goat polyclonal) | Santa Cruz Biotechnology | Cat. #: sc-6688 RRID:AB_647936 |
(1:2000) |
| Antibody | Anti-goat IgG-HRP (mouse monoclonal) | Santa Cruz Biotechnology | Cat. #: sc-6688 RRID:AB_628490 |
(1:5000) |
| Recombinant DNA reagent | p79 (pARS1.4.1) | PMID:3281162 | Plasmid unwinding assay | |
| Recombinant DNA reagent | p470 (pARS305) | PMID:27989437 | Template for MCM loading, phosphorylation, DDK binding, and replication assays | |
| Recombinant DNA reagent | p779 (pRS306G-MCM2/FLAG-MCM3) | PMID:23474987 | Yeast overexpression of Mcm2 and FLAG-Mcm3, template for Mcm2 modifications | |
| Recombinant DNA reagent | p993 (pRS305G-CBP-POB3++) | This paper | Yeast overexpression of CBP-Pob3 | |
| Recombinant DNA reagent | p1000 (pRS306G-SPT16++) | This paper | Yeast overexpression of Spt16 | |
| Recombinant DNA reagent | p1017 (pARS1) | PMID:27989437 | Template for replication assay | |
| Recombinant DNA reagent | p1034 (pRS306G-MCM2-TEV/FLAG-MCM3) | This paper | Yeast overexpression of Mcm2-TEV and FLAG-Mcm3 | |
| Recombinant DNA reagent | p1035 (pet15b-NHP6) | This paper | Bacterial overexpression of His-Nhp6 | |
| Recombinant DNA reagent | p1162 (pRS306G-MCM2-2A/FLAG-MCM3) | This paper | Yeast overexpression of Mcm2-2A and FLAG-Mcm3 | |
| Recombinant DNA reagent | p1220 (pRS305G-CDC7-myc/DBF4-ybbR-FLAG) | This paper | Yeast overexpression of DDK with Cdc7-myc and Dbf4-ybbR-FLAG | |
| Sequence-based reagent | DR772 | IDT | PCR primer | /5PCBio/CCATTATCGAAGGCA |
| Sequence-based reagent | DR2417 | BioSynthesis | PCR primer | TACTGAAATGGTATAC[5-Fluoro-2'-dC]GGTAGATGCATAACGAATTCGCTGCGTAGCATTTGGAG |
| Peptide, recombinant protein | Nap1 (6xHis-Nap1) | PMID:27989437 | ||
| Peptide, recombinant protein | ISW1a (Isw1-3xFLAG) | PMID:27989437 | ||
| Peptide, recombinant protein | ORC (CBP-Orc1) | PMID:23474987 | ||
| Peptide, recombinant protein | Cdc6 | PMID:24566988 | ||
| Peptide, recombinant protein | Cdt1·Mcm2-7WT(3xFLAG-Mcm3) | PMID:23474987 | ||
| Peptide, recombinant protein | Cdt1·Mcm2-72-TEV(3xFLAG-Mcm3) | This paper | Purified from Saccharomyces cerevisiae cells | |
| Peptide, recombinant protein | Cdt1·Mcm2-72-2A(3xFLAG-Mcm3) | This paper | Purified from Saccharomyces cerevisiae cells | |
| Peptide, recombinant protein | DDK (Cdc7-myc) | PMID:24566988 | ||
| Peptide, recombinant protein | DDK (Dbf4-ybbR-3xFLAG/Cdc7 myc) | This paper | Purified from Saccharomyces cerevisiae cells (see Materials and methods) | |
| Peptide, recombinant protein | Sld3·7 (10xHis-Smt3-Sld3) | PMID:27989437 | ||
| Peptide, recombinant protein | Cdc45 (Cdc45-3xFLAGint) | PMID:27989437 | ||
| Peptide, recombinant protein | CDK (Clb5-CBP) | PMID:27989437 | ||
| Peptide, recombinant protein | GINS (Psf1-CBP) | PMID:27989437 | ||
| Peptide, recombinant protein | Pol ε (CBP-Pol2) | PMID:27989437 | ||
| Peptide, recombinant protein | Dpb11 (Dpb11-CBP) | PMID:32341532 | ||
| Peptide, recombinant protein | Sld2 (Sld2-3xFLAG) | PMID:32341532 | ||
| Peptide, recombinant protein | RPA | PMID:27989437 | ||
| Peptide, recombinant protein | Pol α (CBP-Pri1) | PMID:27989437 | ||
| Peptide, recombinant protein | Ctf4 (6xHis-Ctf4) | PMID:27989437 | ||
| Peptide, recombinant protein | RFC (Rfc1-FLAG-HAT) | PMID:27989437 | ||
| Peptide, recombinant protein | PCNA (6xHis-PCNA) | PMID:27989437 | ||
| Peptide, recombinant protein | Pol δ (GST-Pol3) | PMID:27989437 | ||
| Peptide, recombinant protein | Csm3·Tof1 (CBP-Csm3) | PMID:32341532 | ||
| Peptide, recombinant protein | Mrc1 (Mrc1-3xFLAG) | PMID:32341532 | ||
| Peptide, recombinant protein | Mcm10 (6xHis-Mcm10) | PMID:24566988 | ||
| Peptide, recombinant protein | Top1 (Top1-CBP) | PMID:27989437 | ||
| Peptide, recombinant protein | Top2 (CBP-Top2) | PMID:27989437 | ||
| Peptide, recombinant protein | Nhp6 (6xHis-Nhp6) | This paper | Purified from E. coli BL21-CodonPlus (DE3)-RIL cells (see Materials and methods) |
|
| Peptide, recombinant protein | FACT (CBP-Pob3) | This paper | Purified from Saccharomyces cerevisiae cells (see Materials and methods) | |
| Peptide, recombinant protein | Rad53 (6xHis-Rad53) | PMID:32341532 | ||
| Peptide, recombinant protein | Rad53D339A(6xHis-Rad53D339A) | PMID:32341532 | ||
| Peptide, recombinant protein | HpaII methyltransferase | NEB | Cat. #: M0214S | |
| Commercial assay or kit | SilverQuest Silver Staining Kit | Invitrogen (ThermoFisher) | Cat. #: LC6070 | |
| Chemical compound, drug | ATP | Thermo Scientific (Thermo Fisher) | Cat. #: R1441 | |
| Chemical compound, drug | ATPγS | Roche (MilliporeSigma) | Cat. #: 11162306001 | |
| Chemical compound, drug | AMP-PNP | Roche (MilliporeSigma) | Cat. #: 10102547001 | |
| Software, algorithm | ImageJ software | ImageJ (http://imagej.nih.gov/ij/) | RRID:SCR_003070 | |
| Software, algorithm | GraphPad Prism software | GraphPad Prism (https://graphpad.com) | RRID:SCR_015807 |