KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
TH1L (D5G6W) Rabbit mAb (NELFC/D)	Cell Signaling	Cell Signaling Technology Cat# 12265, RRID:AB_2797862
Recombinant Anti-NELFe antibody [EPR11600]	Abcam	Abcam Cat# ab170104, RRID:AB_2827280
Purified Mouse Anti-DSIF Clone 17/DSIF (SPT5)	BD Biosciences	BD Biosciences Cat# 611107, RRID:AB_398420
Anti-RNA polymerase II subunit B1 (phospho CTD Ser-2), clone 3E10	Millipore	Millipore Cat# 04-1571, RRID:AB_11212363
Anti-RNA polymerase II subunit B1 (phospho-CTD Ser-5), clone 3E8	Millipore	Millipore Cat# 04-1572, RRID:AB_10615822
NCBP1/CBP80 Antibody	Bethyl	Bethyl Cat# A301-793A, RRID:AB_1211224
XRN2 antibody	Bethyl	Bethyl Cat# A301-103A, RRID:AB_2218876
DCP2 antibody	Bethyl	Bethyl Cat# A302-597A, RRID:AB_10555903
HSP 90alpha/beta (F-8) antibody	Santa Cruz Biotechnology	Santa Cruz Biotechnology Cat# sc-13119, RRID:AB_675659
Anti-Tubulin, beta E7	DSHB	DSHB Cat# E7, RRID:AB_528499
Rabbit anti-H3K4me3 serum	Shilatifard Laboratory
Chemicals, Peptides, and Recombinant Proteins
Flavopiridol	Cayman	Cat# 10009197
3-indole-acetic acid sodium salt	Abcam	Cat# ab146403
NVP-2	MedChemExpress	Cat# HY-12214A
Paraformaldehyde (Electron Microscopy Sciences)	Fisher Scientific	Cat# 50-980-487
Biotin-11-ATP	PerkinElmer	Cat# NEL544001EA
Biotin-11-CTP	PerkinElmer	Cat# NEL542001EA
Biotin-11-GTP	PerkinElmer	Cat# NEL545001EA
Biotin-11-UTP	PerkinElmer	Cat# NEL543001EA
RNA 5’ Pyrophosphohydrolase (RppH)	NEB	Cat# M0356S
PNK	NEB	Cat# M0201L
T4 RNA ligase I	NEB	Cat# M0204L
Phusion Hot Start II DNA polymerase	ThermoFisher	Cat# F549S
Terminator 5’-triphosphate dependent exonuclease	Lucigen	Cat# TER51020
Quick CIP	NEB	Cat# M0525S
Proteinase K	Roche	Cat# 3115828001
Dynabeads Protein G	ThermoFisher	Cat# 10003D
Protein A/G PLUS-Agarose	Santa Cruz Biotechnology	Cat# sc-2003
Dynabeads Streptavidin M-280	ThermoFisher	Cat# 11205D
2% Agarose, PippinHT, 100-600 bp.10/pkg.	Sage science	Cat# HTC2010
Critical Commercial Assays
HTP Library Preparation Kit	KAPA Biosciences	Cat# KK8234
Agencourt AMPure XP	Beckman Coulter	Cat# A63882
Deposited Data
Raw and processed data	This paper	GEO: GSE144786
Human reference genome GRCh37/hg19	Genome Reference Consortium	https://www.ncbi.nlm.nih.gov/grc/human
Drosophila reference genome BDGP Release 5/dm3	Genome Reference Consortium
Ensembl version 75		http://www.ensembl.org/
RNAPII-nucleosome structure SHL(−5)	(Kujirai et al., 2018)	PDB: 6A5P
RNAPII-nucleosome structure SHL (−1)	(Kujirai et al., 2018)	PDB: 6A5T
Pol II-NELF structure	{Vos:2018cp}	PDB: 6GML
Complex of human nuclear cap-binding complex with m7GTP and NELFe c-terminal peptide	(Schulze and Cusack, 2017)	PDB: 5OOB
DLD1_normoxia_nucleosome	(Yamashita et al., 2011)	https://www.ncbi.nlm.nih.gov/sra/DRX000003
Experimental Models: Cell Lines
DLD-1 OsTIR1	(Holland et al., 2012)	N/A
NELF-C-AID DLD-1 OsTIR1 #7-10B	This paper	N/A
NELF-E-AID DLD-1 OsTIR1 #20-1B	This paper	N/A
Mouse embryonic fibroblasts	Stem cell technology	cat# 00325
S2-DGRC	DGRC	FlyBase: FBtc0000006
Recombinant DNA
YNP37 (Donor plasmid: NELF-C-AID_Neo)	This paper	N/A
YNP38 (Donor plasmid: NELF-C-AID_Hyg)	This paper	N/A
YNP39 (Cas9 plasmid for NELF-C, gRNA: CTGCAAATCTAACTTCATCA)	This paper	N/A
YNP41 (Cas9 for NELF-E, gRNA: CTACAGTGATGACGTCTACA)	This paper	N/A
YNP47 (Donor plasmid: NELF-E-AID_Neo)	This paper	N/A
YNP48 (Donor plasmid: NELF-E-AID_Hyg)	This paper	N/A
Software and Algorithms
Bowtie 2.2.6	(Langmead and Salzberg, 2012)
BEDTools 2.25.0	(Quinlan and Hall, 2010)
R 3.3.3		https://www.r-project.org/
deepTools 3.0.0/3.1.1/3.1.2	(Ramírez et al., 2016)
Bowtie 1.1.2	(Langmead et al., 2009)
iNPS 1.2.2	(Chen et al., 2014)
HOMER 4.10/4.11	(Duttke et al., 2019; Heinz et al., 2010)
RUVseq	(Risso et al., 2014)
DESeq2	(Love et al., 2014)
Trimmomatic 0.33	(Bolger et al., 2014)
cutadapt 1.14	(Martin, 2011)
intervene 0.6.4	(Khan and Mathelier, 2017)
featureCounts 2.0.0	(Liao et al., 2014)