Abstract
Background and Purpose
NALCN is a Na+ leak, GPCR‐activated channel that regulates the resting membrane potential and neuronal excitability. Despite numerous possible roles for NALCN in both normal physiology and disease processes, lack of specific blockers hampers further investigation.
Experimental Approach
The effect of N‐benzhydryl quinuclidine compounds on NALCN channels was demonstrated using whole‐cell patch‐clamp recordings in HEK293T cells overexpressing NALCN and acutely isolated nigral dopaminergic neurons that express NALCN endogenously. Src kinase activity was measured using a Src kinase assay kit, and voltage and current‐clamp recordings from nigral dopaminergic neurons were used to measure NALCN currents and membrane potentials.
Key Results
N‐benzhydryl quinuclidine compounds inhibited NALCN channels without affecting TRPC channels, another important route for Na+ leak. In HEK293T cells overexpressing NALCN, N‐benzhydryl quinuclidine compounds potently suppressed muscarinic M3 receptor‐activated NALCN currents. Structure–function relationship studies suggest that the quinuclidine ring with a benzhydryl group imparts the ability to inhibit NALCN currents regardless of Src family kinases. Moreover, N‐benzhydryl quinuclidine compounds inhibited not only GPCR‐activated NALCN currents but also background Na+ leak currents and hyperpolarized the membrane potential in native midbrain dopaminergic neurons that express NALCN endogenously.
Conclusion and Implications
These findings suggest that N‐benzhydryl quinuclidine compounds have a pharmacological potential to directly inhibit NALCN channels and could be a useful tool to investigate functions of NALCN channels.

Abbreviations
- HCN
hyperpolarization‐activated cyclic nucleotide
- NLF‐1
NCA localization factor‐1
- NMDG
N‐methyl‐d‐glucamine
- R110
rhodamine 110
- RMP
resting membrane potential
- SFK
Src family kinase
- SNc
substantia nigra pars compacta
- TTX
tetrodotoxin
1.
What is already known
NALCN is a Na+ leak channel that determines the resting membrane potential and neuronal excitability.
There is no specific blocker for NALCN channels.
What this study adds
N‐benzhydryl quinuclidine compounds, including L703606, are potent inhibitors of NALCN channels.
L703606 inhibits not only GPCR‐activated NALCN currents but also background Na+ leak currents.
What is the clinical significance
Our findings provide new pharmacological tools for NALCN channels.
N‐benzhydryl quinuclidine compounds can help us to understand many pathophysiological functions of NALCN channels.
1. INTRODUCTION
Recently, the NALCN (Navi2.1) channel has been identified as the long‐sought Na+ leak channel that determines the resting membrane potential (RMP) and neuronal excitability (Lu et al., 2007; Lu, Su, Wang, Wang, & Ren, 2009; Snutch & Monteil, 2007). NALCN is widely expressed in the CNS and many other organs and tissues (Lu et al., 2007; Swayne et al., 2009). NALCN—also named Rb21 in rat (Lee, Cribbs, & Perez‐Reyes, 1999), VGCNL‐1 in human, NA in Drosophila melanogaster, and NCA‐1/2 in Caenorhabditis elegans (Littleton & Ganetzky, 2000)—is a tetrodotoxin (TTX)‐resistant, voltage‐independent, and persistently active Na+‐permeable non‐selective cation channel (Ren, 2011). Although NALCN belongs to a family of voltage‐gated Na+ and Ca2+ channels, it primarily conducts Na+ ions under physiological conditions (Cochet‐Bissuel, Lory, & Monteil, 2014; Lu et al., 2007). Therefore, NALCN could encode the traditional Na+ leak current that determines RMP and basal excitability in central neurons (Flourakis et al., 2015; Lu et al., 2007; Lutas, Lahmann, Soumillon, & Yellen, 2016; Shi et al., 2016).
NALCN is also known to form a large channel complex with many auxiliary proteins, such as UNC80 and UNC79 (Lu, Su, Wang, Wang, & Ren, 2009; Lu et al., 2010). In addition, this NALCN complex, referred to as “NALCN channelosome,” appears to include Src family kinases (SFKs), NCA localization factor‐1 (NLF‐1), and GPCRs (Cochet‐Bissuel, Lory, & Monteil, 2014). In primary mouse hippocampal neurons and dopaminergic neurons of the ventral tegmental area (VTA), peptide neurotransmitters such as substance P and neurotensin can activate NALCN channels through GPCRs, but the coupling from receptor to channel appears to require SFK rather than G‐protein (Lu, Su, Wang, Wang, & Ren, 2009; Ren, 2011). Proper activation of NALCN channels seems to require tyrosine phosphorylation which occurs by recruiting SFK into the channel complex via physical interaction with UNC80 (Wang & Ren, 2009). In addition, ACh is also reported to activate NALCN channels through M3 receptors in pancreatic beta‐cells in a G‐protein‐independent but SFK‐dependent manner (Swayne et al., 2009). However, in contrast to the substance P‐ and neurotensin‐activated NALCN currents that require UNC80 and SFK in neurons (Lu, Su, Wang, Wang, & Ren, 2009), in the non‐neuronal MIN6 pancreatic beta‐cell and HEK293 cell lines, coexpression of only M3 receptors and NALCN appears to sufficiently reconstitute NALCN currents via direct physical interaction between the I‐II loop of NALCN and the i3 loop of the M3 receptor (Swayne et al., 2009).
Since NALCN was recognized as a new putative ion channel in neurons (Lee, Cribbs, &Perez‐Reyes, 1999), it has been also reported in many organs, including the heart, thyroid gland, adrenal gland, lymph node, and pancreas (Köroğlu, Seven, & Tolun, 2013; Rorsman & Braun, 2013; Swayne et al., 2009). Many genetic studies in mammalian cells have shown a variety of physiological and pathological roles for NALCN channels. Mutations and/or deletions of the NALCN gene lead to disruption of rhythmic respiratory activity (Lu et al., 2007; Shi et al., 2016; Yeh et al., 2017), pacemaker activity (Kim et al., 2012), systemic osmoregulation (Sinke et al., 2011), and neonatal death (Lu et al., 2007). Nevertheless, many other functions and mechanisms of NALCN remain elusive. To date, only Gd3+ ions and SFK inhibitors, which may also inhibit many other ion channels, have been used as blockers for NALCN channels (Lu et al., 2007). Lack of specific blockers for NALCN channels hampers and delays further studies of NALCN as an ion channel.
Here, we report that compounds containing the N‐benzhydryl quinuclidine structure inhibit NALCN channels in a Src‐independent manner without affecting another candidate channel for Na+ leak, the TRPC channels. In midbrain dopaminergic neurons expressing NALCN endogenously, the N‐benzhydryl quinuclidine compounds inhibited both the basally active Na+ leak currents and neurotensin‐evoked inward Na+ currents and hyperpolarized the membrane potential. Therefore, N‐benzhydryl quinuclidine compounds could be a powerful tool to study the pathophysiological roles of NALCN channels and shed light on development of therapeutic agents to treat NALCN‐related diseases.
2. METHODS
2.1. DNA constructs and mutagenesis
The following constructs were kindly provided to us: pTracer‐CMV2‐NALCN (GenBank accession number: NM_153630) (from Dr. D. Ren, University of Pennsylvania, USA). pRK5‐HA‐ M3 receptor (accession number: NM_001375985) (from Dr. K.P. Lee, Chungnam National University, Korea). pcDNA3.1(+)‐UNC80 (accession number: NM_175510) and pcDNA3‐Src (Src529) with a Y529F mutation (accession number: NM_001025395) (from Dr. H. Cho, Sungkyunkwan University, Korea). pcDNA3.1‐TRPC3 (accession number: NM_001366479), pEYFP‐N1‐TRPC4α (accession number: NM_016179), pGFP‐M‐TRPC5 (accession number: NM_009428), pEGFP‐C2‐TRPC6 (accession number: NM_001282086), and a pEGFP‐C2‐TRPC7 (accession number: NM_012035) (from Dr. I. So, Seoul National University, Korea). SCN5A‐IRES‐GFP (accession number: NM_198056) (from Dr. J.S. Kang, Sungkyunkwan University, Korea). For CaV 1.2 expression, pBluescript SK(+)‐α1C (accession number: X15539), pcDNA3.1‐α2δ1 (accession number: AF_286488), and pEGFP‐N1‐β1b (accession number: NM_017346) subunit (from Dr. B.C. Suh, DGIST, Korea). pcDNA6‐CaV 2.1 (accession number: AY714490) was a gift from Diane Lipscombe (Addgene plasmid 26578, http://n2t.net/addgene; RRID: Addgene_26578) (Richards, Swensen, Lipscombe, & Bommert, 2007). NALCN L509S and NALCN Y578S were generated from the pTracer‐CMV2‐NALCN wild‐type (WT) plasmid by using a site‐directed mutagenesis protocol as reported previously (Bouasse, Impheng, Servant, Lory, & Monteil, 2019). The primers used for mutagenesis are provided in Table 1. Mutants were verified by sequencing.
TABLE 1.
List of primers used for mutagenesis of NALCN
| Primer | Forward (5′‐3′) | Reverse (5′‐3′) |
|---|---|---|
| NALCN L509S | GGG AAA AAA CTT GGA AGC TCG GTG GTG TTC ACT GCC AGT | ACT GGC AGT GAA CAC CAC CGA GCT TCC AAG TTT TTT CCC |
| NALCN Y578S | GCT CCA CTG GTT GCC ATC TCT TTC ATC CTC TAC CAT CTC | GAG ATG GTA GAG GAT GAA AGA GAT GGC AAC CAG TGG AGC |
2.2. Cell culture and transfection
HEK293T (RRID: CVCL‐0063, CRL‐3216, ATTC, VA, USA) cell line was grown in DMEM (D5796, Sigma‐Aldrich, MO, USA) supplemented with 10% FBS (Gibco) and 1% antibiotics (Gibco) in a humidified incubator containing 95% air and 5% CO2 at 37°C. Cells were co‐transfected with M3 receptors plus NALCN, or with M3 receptors and pEGFP‐C2 as a marker, or with M3 receptors and NALCN plus UNC80 and Src529. For knockdown experiments, we used siRNAs that target the following human NALCN sequences: siRNA‐1 had the sequences 5′‐CAGAAGAAACCGAUACGAU‐3′ (sense) and 5′‐AUCGUAUCGGUUUCUUCUG‐3′ (antisense). siRNA‐2 had the sequences 5′‐AGAUGCUCCUCUUGACAGU‐3′ (sense) and 5′‐ACUGUCAAGAGGAGCAUCU‐3′ (antisense) and scramble siRNA for negative control (Bioneer, Daejeon, Korea). To express functional CaV channels, α1, α2δ1, and β1b subunit in a 1:1:1 molar ratio was transiently co‐transfected in cells. Transfection was carried out using Lipofectamine 2000 (11668019, Invitrogen, Korea) as the reagent. Transfected HEK293T cells were replated on the cover slips and placed inside 35‐mm dishes prior to experiments. Recordings were performed at 48–55 h in cells over‐expressing M3 receptors and NALCN, at 36–48 h in cells co‐expressing M3 receptors and TRPCs, and at 48–72 h in HEK293T cells co‐expressing M3 receptors, NALCN, UNC80, and Src529‐. The M3 receptor and GFP transfection was repeated 72 h after siRNAs transfection. NaV1.5‐, CaV1.2‐, and CaV2.1‐expressing HEK293T cells were used 36–48 h later. Electrical recording and western blotting were carried out after an additional 24 h. Transfected cells were identified using a GFP marker.
2.3. Animals
STOCK Tg (TH‐eGFP) DJ76Gsat/Mmnc strain (RRID: MMRRC_000292‐UNC) obtained from NIH Mutant Mouse Regional Resource Centers (MMRC, CA, USA) were maintained as heterozygous mice by breeding with ICR (CrljOri: CD1) inbred mice (RRID: IMSR_TAC:icr, Orient Bio, Korea). Of these, we used transgenic mice expressing eGFP driven by the TH promoter to acutely dissociate single dopaminergic neurons. Transgenic mice were identified by PCR of genomic toe‐biopsy DNA, and eGFP DNA was amplified, using the following primers: forward 5′‐CCT ACG GCG TGC AGT GCT TCA GC‐3′ and reverse 5′ CGG CGA GCTGCA CGC TGC GTC CTC‐3′.
Mice were housed, at no more than five per sterile and ventilated cage, in an air‐conditioned and specific pathogen‐free room. The mice were kept at constant temperature of 21–23°C and 12‐h light/dark cycles and fed a standard food and water ad libitum. In all experiments, we used both male and female mice (postnatal day 18–26) weighing 9–12 g.
2.4. Preparation of single dopaminergic neurons
To obtain dissociated dopaminergic neurons, TH‐eGFP mice (RRID: MGI:3846704) were anaesthetized with CO2. After decapitation, the brain was removed rapidly under ice‐cold high‐glucose solution oxygenated with 100% O2. The high‐glucose solution consisted of the following (in mM): 135 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 25 d‐glucose, and 10 HEPES pH 7.3 with NaOH (osmolarity ~310 mOsm). The midbrain was sliced in the coronal direction at a 300 μm thickness using a vibratome (Series 1000, Technical Products International, MO, USA). The substantia nigra par compacta (SNc) regions were excised from the slices, and the tissues containing dopaminergic neurons were then incubated in the high‐glucose solution with 4 U·ml−1 of papain (Worthington Biochemical Corp., NJ, USA) for 20–30 min at 36–37°C. After enzymatic digestion, the tissues were washed three to four times with high‐glucose solution at 36°C. Using Pasture pipettes with varying pore sizes, gentle serial agitation was conducted to dissociate single dopaminergic neurons from the SNc tissues. The dissociated neurons were attached to poly‐d‐lysine (0.01%)‐coated cover slips for 30 min at room temperature.
2.5. RT‐PCR and western blotting
RT‐PCR was used to confirm mRNA expression level in transfected HEK293T cells. The primers used in this experiment are provided in Table 2. All PCRs for NALCN and ß‐actin in HEK293T cells and dopaminergic neurons were carried out under the same conditions and comprised 45 cycles: 2‐min denaturation at 94°C, 30‐s primer annealing at 55°C, and 30‐s extension at 72°C using EmeraldAmp GT PCR Master Mix (Takara Bio, Seoul, Korea).
TABLE 2.
List of primers used for RT‐PCR
| Gene | Forward (5′‐3′) | Reverse (5′‐3′) | size |
|---|---|---|---|
| Human NALCN | TCAGAAACTTTTGCCGGGTA | CTTCGAAACGGGGACTCAA | 197 bp |
| Rat NALCN | TGATGGGAGCCTGTGTGATT | ACAGTGCCAAACAGAACCAC | 178 bp |
| Human ß‐actin | GTGCTATCCCTGTACGCCTC | AATGCCAGGGTACATGGTGG | 510 bp |
| Mouse NALCN | TCCAAACAGACCGCAAATGG | GCTGAAAACAGACTTGCGGA | 229 bp |
| Mouse ß‐actin | TGTTACCAACTGGGACGACA | GGGGTGTTGAAGGTCTCAAA | 165 bp |
For western blotting, the transfected HEK293T cells were collected and lysed on ice for 30 min in protein lysis buffer (1‐mM Na3VO4, 1‐mM NaF, complete protease inhibitor cocktail [Roche, Seoul, Korea], and 1% Triton X‐100 in PBS). The protein samples were separated by SDS‐PAGE and transferred to a hydrophobic PVDF membrane. The membranes were blocked in 5% skim milk in Tween Tris‐Buffered Saline (TTBS) for 1 h at room temperature and then incubated in 1:1,000 anti‐NALCN (ASC‐022, Alomone labs, RRID: AB_11120881) and 1:1,000 anti‐pan cadherin (ab6528, abcam, RRID: AB_305544) for 18 h at 4°C. After three washes, the membranes were incubated for 2 h at room temperature with HRP‐conjugated rabbit secondary antibody (170‐6515, Bio‐RAD, RRID: AB_11125142) for NALCN detection and HRP‐conjugated mouse secondary antibody (170‐6516, Bio‐RAD, RRID: AB_11125547) for pan cadherin detection and then washed. The blot was developed using an enhanced chemiluminescence (ECL) reagent (GE Healthcare, IL, USA). The immuno‐related procedures used comply with the recommendations made by the British Journal of Pharmacology (Alexander et al., 2018).
2.6. Electrophysiological recordings on HEK293T cells
All recordings were carried out using a whole‐cell patch clamp (EPC‐9, HEKA Elektronik, Lmbrecht, Germany). Patch pipettes were pulled (MODEL PP‐803, Narishige, NY, USA) from borosilicate glass capillaries of 1.5‐mm outer diameter (World Precision Instruments, FL, USA) to give 3.5‐ to 5‐MΩ resistance. HEK293T cells expressing GFP were only used for recordings. For carbachol (GL9772, Glentham, Corsham, UK)‐activated NALCN current recording, the pipette solution contained the following (in mM): 100 K‐aspartate, 25 KCl, 10 NaCl, 2 Mg‐ATP, 0.1 Na‐GTP, 5 creatine phosphate, 5 HEPES, 0.01 CaCl2, and 1 MgCl2 adjusted to pH 7.2 with KOH (osmolarity ~295 mOsm). The bath solution consisted of the following (in mM): 119 NaCl, 4 KCl 4, 1.2 KH2PO4, 1.2 MgSO4, 2.5 CaCl2, 20 HEPES, 10 d‐glucose, and 0.42 g·L−1 of Na2CO3 adjusted to pH 7.2 with NaOH (osmolarity ~310 mOsm·L−1) (Swayne et al., 2009). In the N‐methyl‐d‐glucamine (NMDG) solution, Na+ was replaced by equimolar NMDG. The I‐V relationships were determined using 200‐ms step voltage from −80 mV to +20 or +10 mV.
For TRPC recordings at −80 mV, the external solution contained the following (in mM): 140 CsCl, 2 CaCl2, 1 MgCl2, 5 d‐glucose, and 10 HEPES adjusted to pH 7.35 with CsOH (osmolarity ~310 mOsm·L−1). The pipette solution contained the following (in mM): 140 CsCl, 0.2 Tris‐GTP, 2 EGTA, 10 HEPES, and 3 Mg‐ATP adjusted to pH 7.3 with CsOH (osmolarity ~295 mOsm·L−1).
To record NaV current and two NALCN mutant currents, cells were superfused with external solution containing (in mM) 143 NaCl, 5.4 KCl 4, 0.5 MgCl2, 5 HEPES, 11.1 d‐glucose, 1.8 CaCl2, and 0.5 Na2HPO4 adjusted to pH 7.4 with NaOH (osmolarity ~300 mOsm·L−1). The pipette solution contained (in mM) 10 NaCl, 10 EGTA, 4 Mg‐ATP, 10 HEPES, 20 TEA‐Cl, and 110 CH3CsO3S adjusted to pH 7.2 with CsOH (osmolarity ~295 mOsm·L−1). Transient Na+ current was evoked by a depolarization from a holding potential of −90 to −20 mV within 20 ms. Na+ background currents from NALCN mutants were measured by a voltage ramp command from −100 to +100 mV for 500 ms.
For CaV recordings, the external solution contained (in mM) 140 TEA‐Cl, 2 MgCl2, 10 HEPES, 10 d‐glucose, and 3 BaCl2 adjusted to pH 7.4 with KOH (osmolarity ~300 mOsm·L−1). The pipette solution contained (in mM) 10 NaCl, 10 EGTA, 4 Mg‐ATP, 10 HEPES, 20 TEA‐Cl, and 110 CH3CsO3S adjusted to pH 7.2 with CsOH (osmolarity ~295 mOsm·L−1). L‐type and P‐type Ba2+ currents were induced by a depolarization from a holding potential of −90 mV to 10 mV and 20 mV for 200 ms respectively.
2.7. Electrophysiological recording and micropressurized injection on dissociated dopaminergic neurons
In midbrain dopaminergic neurons, NaV current was measured with the external solution containing (in mM) 145 NaCl, 4 KCl 4, 1 MgCl2, 10 HEPES, 5 d‐glucose, 1 CaCl2, 2 CsCl, and 0.3 CdCl2 adjusted to pH 7.3 with NaOH (osmolarity ~300 mOsm·L−1). A depolarizing pulse from holding potential of −96 to −20 mV for 1 ms induced the transient Na+ current. CaV current was measured with the external solution containing (in mM) 145 TEA‐Cl, 3 BaCl2, 2 MgCl2, 10 HEPES, 5 d‐glucose, and 3 4‐AP adjusted to pH 7.4 with CsOH (osmolarity ~300 mOsm·L−1). A depolarizing pulse from holding potential of −80 to 10 mV for 200 ms elicited the transient Ca2+ current.
To record leak current and membrane potential of midbrain dopaminergic neurons, we used the normal bath solution containing the following (in mM): 140 NaCl, 5 KCl 4, 1 CaCl2, 1 MgCl2, 10 HEPES, and 10 d‐glucose, pH adjusted to 7.4 with NaOH (osmolarity ~300 mOsm·L−1). For recordings in dopaminergic neurons, the patch pipettes were filled with the internal solution (in mM): 120 CsMeSO4, 20 CsCl, 10 HEPES, 4 Mg‐ATP, 0.3 Na‐GTP, 14 Na2‐phosphocreatine, and 3 Na‐vitamin C, adjusted to pH 7.3 with CsOH (osmolarity ~295 mOsm·L−1).
For short‐term application of neurotensin to dopaminergic neurons, a pressure microinjection system (Toohey Company, NJ, USA) was used. The injection glass pipette was filled with the external bath solution containing 10‐μM neurotensin (1909, Tocris, Bristol, UK). The single‐pulse duration was 1 s. The micropressure glass pipettes were purchased from Narishige (Model GD‐1, NY, USA), and pipette resistance was between 10 and 20 MΩ. The injection pressure was maintained between 275 and 345 kPa. Experiments were conducted during the period of 1–3 h after dissociation.
2.8. SFK assay
The SFK assay was conducted using the SFK assay kit (V1270, Promega, WI, USA), which measures the enzymic activity of SFKs in 96‐well black immunoplates. In accordance with the kit protocol, N‐benzhydryl quinuclidine compounds were added to the reaction buffer along with rhodamine 110 peptide substrate (R110), AMC control substrate, and 1 μg of active Src kinase (V2921, Promega, WI, USA). In the case of inhibition of SFK or lack of kinase activity, bisamide derivatives of R110 peptide are unphosphorylated. A protease in the termination buffer removes specific amino acids from the substrates, producing highly fluorescent R110 substrates. If bisamide substrates are phosphorylated by SFK, they become resistant to cleavage by the protease and remain in the non‐fluorescent state, indicating that the measured fluorescence intensity reflects SFK activity. Following the kinase reaction, addition of a termination buffer containing protease reagent resulted in production of highly fluorescent R110. R110 signals were read at an excitation wavelength of 485 nm and emission wavelength of 530 nm. AMC control signals were read at an excitation wavelength of 355 nm and emission wavelength of 460 nm using a microplate reader and Gen5 (RRID: SCR_017317, BioTek, VT, USA).
2.9. Materials
To compare the inhibitory effects of various compounds, PP1 (GK9287, Glentham, Corsham, UK), L703606 (GL7643, Glentham, Corsham, UK), CP96345 (2893, Tocris, Bristol, UK), maropitant (M197300, Toronto Research Chemicals, ON, Canada), CP99994 (3417, Tocris, Bristol, UK), and L733060 (GX7824, Glentham, Corsham, UK) dissolved in DMSO or water were freshly added to bath solution before use. Src activator (sc‐3052, Santa Cruz Biotechnology, TX, USA) was contained in pipette solution. TTX (GL8460, Glentham, Corsham, UK), 4‐AP (A0152, Sigma‐Aldrich, MO, USA), GdCl3 (G7532, Sigma‐Aldrich, MO, USA), ZD7288 (1000, Tocris, Bristol, UK), PP1, and L703606 were added to external solution. To block L‐type and P‐type Ca2+ channels and TRPC family channels, nifedipine (1075, Tocris, Bristol, UK), ω‐Agatoxin IVA (2799, Tocris, Bristol, UK), and SKF96365 (1147, Tocris, Bristol, UK) were used.
2.10. Data and statistical analysis
The data and statistical analysis comply with the recommendations of the British Journal of Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2018). We selected currents with equal sizes before addition of drugs as controls to precisely measure drug effects. Current recordings were analysed and fitted using Igor Pro 4.01 (RRID: SCR_000325, WaveMetrics, Inc., OR, USA) and Origin 7.0 (OriginLab Corp., MA, USA) software. The experiments were not carried out under randomization or in a blind manner, but controlled designs. The sample size is the number of independent values in each group, and statistical analysis was performed using these independent values. Outliers were included in data analysis. In some cases, data were normalized to minimize the variations between several experiments, and expressed as “normalized to control,” “inhibition (%),” or “normalized current” to compare with the corresponding control value. To plot dose–response curves, different concentrations of N‐benzhydryl quinuclidine compounds were converted to logarithmic scales, and normalized currents were fitted by a non‐linear fitting with variable Hill slope. All measured numerical values and graphical results are presented as mean ± SEM. Data were analysed by Student's paired t‐test between two groups, or one‐way ANOVA followed by Tukey's post hoc test (only when F achieved P < 0.05) for multiple comparisons, and there was no significant variance inhomogeneity. P values of <0.05 were considered statistically significant. Experiments were repeated at least five times; n refers to the number in each group (n = 5 or n > 5).
2.11. Nomenclature of targets and ligands
Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018), and are permanently archived in the Concise Guide to PHARMACOLOGY 2019/20 (Alexander, Christopoulos et al., 2019; Alexander, Fabbro et al., 2019; Alexander, Mathie et al., 2019).
3. RESULTS
3.1. Overexpression of M3 receptors and NALCN channels in HEK293T cells
To measure activity of the NALCN channel, we used HEK293T cells overexpressing M3 receptors and NALCN, as previously reported (Swayne et al., 2009). First, we examined NALCN mRNA and protein expression in WT and transfected HEK293T cells using RT‐PCR and western blot analyses. Although endogenous NALCN mRNA and protein were found in our HEK293T cells, their expression increased significantly after transfection of NALCN cDNA (Figure 1a). In these HEK293T cells, application of carbachol, a muscarinic receptor agonist, did not elicit any inward current at the holding potential of −80 mV (Figure 1b,c), owing to the lack of endogenous muscarinic receptors. However, when M3 receptors were expressed in HEK293T cells, carbachol induced a measurable inward current, but further overexpression of NALCN markedly increased this inward current (Figure 1b,c). As muscarinic receptors may activate other nonselective cation channels, such as TRPC channels (Beck et al., 2006; Jeon et al., 2012; Lee et al., 2003; Thakur et al., 2016; Tsvilovskyy et al., 2009), we confirmed the NALCN current measured in HEK293T cells using siRNAs that specifically knock down NALCN (Figure S1). Two different siRNA sequences significantly reduced the expression of NALCN mRNA and protein (Figure S1a). Consistent with these results, the carbachol‐evoked current was clearly reduced in NALCN‐siRNA transfected cells compared with scramble siRNA‐negative control and WT HEK293T cells (Figure S1b,c), indicating that the carbachol‐activated current in native and transfected HEK293T cells mainly flows through NALCN channels under our experimental conditions.
FIGURE 1.

M3 receptor (M3R)‐activated NALCN currents in wild‐type and NALCN‐overexpressing HEK293T cells. (a) Expression of endogenous and transfected NALCN in HEK293T cells as assessed by RT‐PCR and western blot analyses. (b) Representative traces of inward currents induced by carbachol (CCh; 100 μM) at a holding potential of −80 mV in wild‐type (WT), M3R‐expressing, and M3R and NALCN‐coexpressing HEK293T cells. (c) Average current density induced by Carbachol at −80 mV in different cell groups; n = 5 for WT‐HEK293T, n = 10 for M3R, n = 24 for M3R + NALCN. (d) The carbachol‐induced currents were completely suppressed by substitution of Na+ with equimolar NMDG. (e) Application of TTX (0.5 μM) did not affect the carbachol‐induced current. (f) Gd3+ (100 μM) inhibited the current. (g,h) Summary of normalized carbachol‐evoked currents illustrated in (d)–(f) (n = 6 for each group). (i) Average I‐V relationships of the carbachol‐evoked currents obtained by step‐voltage protocols (−80 to 0 mV in steps of +20 mV for 200 ms) in M3R‐expressing, and M3R and NALCN co‐expressing cells. The values obtained before carbachol application were subtracted from the values obtained after carbachol application (n = 9 for M3R , n = 8 for M3R + NALCN). Arrows indicate the zero current level. * P < .05, significantly different as indicated; one‐way ANOVA followed by Tukey's test
We then examined ion permeation and pharmacological properties of the carbachol‐evoked current. When Na+ was replaced with a large impermeable cation, NMDG, the carbachol‐induced current rapidly decreased to baseline in both cells expressing M3 receptors and cells co‐expressing M3 receptors and NALCN (Figure 1d,g,h), suggesting that Na+ was the major permeable cation. This current was resistant to TTX (Figure 1e,g,h) but was strongly inhibited by gadolinium (Gd3+) in both M3 receptor‐expressing and the M3 receptor and NALCN‐coexpressing cells (Figure 1f–h). In addition, the carbachol‐induced current measured by step‐voltage pulses did not show any inactivation (Figure S2a,b). The average current–voltage (I‐V) relationship was linear in the negative membrane potential range, indicating the voltage independence of the channel. Therefore, the carbachol‐evoked current measured in native and transfected HEK293T cells is permeable to Na+, TTX‐insensitive, and Gd3+‐sensitive. These results are consistent with the previously reported properties of NALCN channels (Lu et al., 2007; Swayne et al., 2009).
3.2. L703606 inhibits M3 receptor‐activated NALCN currents
(2S,3S)‐2‐Benzhydryl‐N‐((2‐iodophenyl)methyl)‐1‐azabicyclo(2.2.2)octan‐3‐amine (L703606) was originally developed as a competitive non‐peptide NK1 tachykinin receptor antagonist (Cascieri et al., 1992). However, we have found that L703606 is involved in inhibition of NALCN currents. Therefore, we examined whether L703606 inhibits the carbachol‐activated current in M3 receptor‐expressing and M3 receptor and NALCN co‐expressing HEK293T cells. Because M3 receptor‐mediated NALCN currents were reported to be inhibited by PP1, an inhibitor of SFK (Swayne et al., 2009), we first ascertained whether PP1 blocked the carbachol‐activated NALCN current in our recombinant system. As reported, PP1 significantly suppressed the carbachol‐induced current in M3 receptor‐expressing and M3 receptor and NALCN co‐expressing HEK293T cells (Figure 2a,b). The inhibition was more prominent in M3 receptor‐expressing HEK293T cells than in the M3 receptor and NALCN‐coexpressing cells. Nonetheless, despite the large difference in current amplitudes, the magnitude of the current blocked by PP1 in M3 receptors‐expressing cells was equal to that of the current blocked by PP1 in M3 receptor and NALCN co‐expressing cells (Figure 2a,c), suggesting that PP1 suppresses the activated NALCN channels by inhibiting the endogenous SFK. Nevertheless, L703606 almost completely blocked the carbachol‐evoked currents M3 receptor‐expressing and M3 receptor and NALCN co‐expressing HEK293T cells (Figure 2d,f). In the cells co‐expressing M3 receptors and NALCN, after PP1 treatment, subsequent application of L703606 further blocked the residual currents (Figure 2e). Pretreatment with L703606 completely blocked the carbachol‐induced current, but after wash‐out of L703606, re‐application of carbachol activated the current (Figure S3a,c). Unlike the previous reports indicating that activation of NALCN channels depends on SFK (Lu, Su, Wang, Wang, & Ren, 2009; Swayne et al., 2009), carbachol was able to evoke inward currents in the presence of PP1 in HEK293T cells co‐expressing M3 receptors and NALCN. The carbachol‐evoked current was smaller in the presence of PP1 than in the absence of PP1, but the current remaining after PP1 treatment was completely suppressed by L703606 (Figure S3b). To further clarify whether SFK is essential for carbachol‐evoked NALCN activation, we added an SFK activator in a patch pipette for intracellular dialysis (Figure S3d). After establishment of the whole‐cell configuration (infusion of an SFKs activator), the basal current measured at −80 mV was not changed. Even under these conditions, carbachol application induced clear inward currents that were completely inhibited by L703606. In the presence of PP1, the carbachol‐induced current was smaller than that in controls (Figure S3d). The magnitude of inward currents reduced by PP1 after dialysis with the SFK activator was similar to that measured in the normal internal solution (Figure S3f), suggesting that, although inhibition of SFK reduced the carbachol‐activated NALCN currents significantly, SFK did not appear to be essential for activation of NALCN channels in our M3 receptor and NALCN recombinant system. The carbachol‐evoked current measured during step pulses in our recombinant system also showed a linear I‐V relationship (Figure 2g,h) similar to the previously reported NALCN current (Lu et al., 2007; Swayne et al., 2009).
FIGURE 2.

Inhibitory effects of L703606 on carbachol‐activated NALCN currents in M3 receptors (M3R)‐expressing and M3 receptors and NALCN co‐expressing HEK293T cells. (a) Transmitted light image of M3R and NALCN co‐expressing HEK293T cells (left). Traces of the whole‐cell currents in response to carbachol (100 μM) and PP1 (50 μM) (right). The proportion of currents inhibited by PP1 was greater in M3R‐expressing cells than in M3R and NALCN‐coexpressing cells. (b) Percent inhibition of M3R‐activated NALCN currents by PP1 (left, n = 5 for M3R, n = 9 for M3R + NACLN). (c) Amplitudes of the carbachol‐activated inward currents inhibited by PP1 were similar between M3R‐expressing and M3R and NALCN‐coexpressing cells (right, n = 8 for M3R, n = 10 for M3R + NALCN). (d) L703606 (50 μM) completely suppressed the M3R‐induced NALCN currents in both M3R‐expressing and M3R and NALCN‐coexpressing cells. (e) After application of PP1, L703606 completely inhibited the remaining NALCN currents. (f) Percentage inhibitions of M3R‐activated NALCN currents by L703606 (n = 8 for M3R, n = 10 for M3R + NALCN). (g) Representative current traces recorded by step‐voltage protocols (lower left, for 200 ms) in the presence of carbachol, carbachol + PP1, and carbachol + L703606. (h) Average I‐V relationship of the carbachol‐evoked currents in (g). * P < .05, significantly different as indicated, n.s = not significant; one‐way ANOVA
Because muscarinic receptors can also activate cation channels of the TRPC family (Beck et al., 2006; Jeon et al., 2012; Lee et al., 2003; Thakur et al., 2016; Tsvilovskyy et al., 2009), we examined whether L703606 inhibits TRPC channels in M3 receptor and TRPC‐coexpressing HEK293T cells (Figure S4). In WT HEK293T cells expressing only M3 receptors, carbachol evoked very small inward currents at −80 mV under a Cs+‐rich TRPC current recording condition (Lee et al., 2003), but it evoked markedly larger currents in the HEK293T cells expressing each type of TRPC channels. These TRPC currents gradually decreased upon repeated ACh stimulation, in contrast to the sustained NALCN currents recorded in response to the same ACh stimulation (Figures 1 and 2). In all HEK293T cells expressing individual TRPC channels (TRPC3, TRPC4, TRPC5, TRPC6, or TRPC7), L703606 did not suppress the carbachol‐induced currents at all (Figure S4f), raising the possibility that L703606 blocked NALCN channels specifically.
3.3. The N‐benzhydryl quinuclidine structure is important for inhibition of NALCN
As L703606 is derived from CP96345 (Cascieri et al., 1992), these two compounds share the same core structure, N‐benzhydryl quinuclidine, with L703606 having an iodine group instead of a methoxy group. We investigated the relationship between the structure and inhibitory action of L703606 analogues for NALCN channels in HEK293T cells co‐expressing M3 receptors and NALCN. Similar to the inhibitory effect of L703606 (Figure 3a), CP96345 markedly reduced the NALCN currents (Figure 3b,f). The NK1 receptor antagonist maropitant, the structure of which consists of CP96365 with an added tert‐butyl group, also abolished the carbachol‐evoked NALCN current (Figure 3c,f). In contrast, CP99994 and L733060, which are also NK1 receptor antagonists, but have a different core structure, compared to CP96365, did not block the current to the same degree as the N‐benzhydryl quinuclidine compounds (Figure 3d–f), and the IC50s of the two groups differ significantly (Figure 3g). Therefore, the N‐benzhydryl quinuclidine structure appears to play a key role in inhibition of NALCN channels (Figure 3h).
FIGURE 3.

L703606 analogues of quinuclidine suppress carbachol‐activated NALCN currents in M3 receptor (M3R) and NALCN‐coexpressing HEK293T cells. (a–e) L703606 (50 μM), CP96345 (50 μM), and maropitant (50 μM), which share a common structure, strongly inhibited the M3R‐induced NALCN currents, but CP99994 (50 μM) and L733060 (50 μM), having a different core structure from the first three compounds, did not strongly inhibit the NALCN currents. All traces obtained at 50 μM of each compound. (f) Comparison of inhibition of NALCN currents by the above compounds (n = 8 for L703606, n = 5 for CP96345, maropitant, CP99994, and L733060, respectively). (g) Dose‐inhibition curves with IC50 in M3R and NALCN‐coexpressing cells. The normalized currents were measured at −80 mV (n = 5 for CP99994, L733060, CP96345, and L703606, n = 6 for maropitant). (h) Chemical structure of N‐benzhydryl quinuclidine compounds. Blue box indicates the core structure responsible for NALCN channel inhibition
3.4. Potent and Src kinase‐independent inhibition of NALCN currents by N‐benzhydryl quinuclidine compounds in the NALCN complexes containing Src kinase
NALCN forms a large channel complex, and SFK and UNC80 are necessary components of the channel complex for GPCR to activate NALCN (Lu, Su, Wang, Wang, & Ren, ; Lu et al., 2010; Wang & Ren, 2009). Although the carbachol‐evoked current was conveniently reproduced in the M3 receptor and NALCN co‐expressing HEK293T cells, this minimal heterologous co‐expression system is not a usual case. Therefore, we further examined how L703606 affects NALCN currents in the HEK293T cells co‐expressing M3 receptors, NALCN, UNC80, and Src529 kinase (Wang & Ren, 2009). In this more natural condition, PP1 almost completely suppressed the carbachol‐evoked NALCN current (Figure 4a,b), like the endogenous NALCN current in cells expressing only M3 receptors, but not in cells co‐expressing M3 receptors and NALCN (Figure 2a–c). These results indicate that the NALCN complexes in these cells appear to contain Src kinase. Importantly, in the above four components‐co‐expressing HEK293T cells, including the cells only expressing M3 receptors, L703606 strongly inhibited the carbachol‐evoked NALCN current, even at very low concentrations (Figure 4c,d). IC50s in these cells are much lower than in the M3 receptor and NALCN co‐expressing cells (Figures 3g and 4d). Nonetheless, it is still not known if N‐benzhydryl quinuclidine compounds can directly inhibit SFK. We therefore carried out an SFK assay (Figure 4e). Src kinase activity can be measured by increases in fluorescence intensity with a test substrate (Figure 4e, left). PP1 in standard reaction solution gradually increased the fluorescence intensity, but L703606, CP96365, or maropitant at even supramaximal concentrations had no effect on fluorescence intensity (Figure 4e, right), indicating that N‐benzhydryl quinuclidine compounds do not affect SFK activity. Therefore, it can be concluded that N‐benzhydryl quinuclidine compounds inhibit NALCN channels, independent of the presence or activity of SFK.
FIGURE 4.

Potent and Src‐independent inhibition of NALCN currents by L703606 in the NALCN complex containing Src kinases. (a) Representative current traces elicited by hyperpolarizing step pulses (lower left) before (control and carbachol, CCh) and after addition of PP1 (50 μM) in M3 receptor (M3R)‐expressing and M3R, NALCN, UNC80, and Src529 kinase‐coexpressing HEK293T cells. PP1 almost completely suppressed carbachol‐activated NALCN currents in M3R, NALCN, UNC80, and Src529 kinase co‐expressing cells. (b) Summary of the normalized Carbachol‐evoked currents before and after addition of PP1 at −90 mV in the above four components co‐expressing cells (n = 7, Student's t‐test). (c) Representative current traces elicited by hyperpolarizing step pulses before (control and carbachol) and after exposure to L703606 at three different concentrations in M3R‐expressing and M3R, NALCN, UNC80, and Src529 kinase‐coexpressing HEK293T cells. L703606 almost completely inhibited carbachol‐activated NALCN currents from 3 μM in the four components‐coexpressing cells. (d) Dose‐inhibition curves with IC50 in M3R‐expressing (n = 5) and the four components‐coexpressing (n = 5) cells. (e) SFK assay of N‐benzhydryl quinuclidine compounds. Schematic diagram of the SFK assay kit—methodology (left). The high fluorescence intensities were observed in control solution (no activity of SFK) regardless of ATP (right). Application of PP1 progressively increased the fluorescence intensity. L703606, CP96345, and maropitant did not affect the fluorescence intensity, significantly (n = 8, one‐way ANOVA followed by Tukey's test). * P < .05, significantly different as indicated
3.5. Direct and potent inhibition of the NALCN current by N‐benzhydryl quinuclidine compounds in the CLIFAHDD variants of NALCN
Recently, two CLIFAHDD pathogenic variants were reported to increase NALCN channel activity by missense mutation of the pore‐forming region (Bouasse, Impheng, Servant, Lory, & Monteil, 2019). The L509S and Y578S CLIFAHDD mutants were shown to conduct higher background currents compared to WT NALCN. To further examine whether N‐benzhydryl quinuclidine compounds directly inhibit NALCN channels, we used the gain‐of‐function properties of L509S and Y578S NALCN mutants in HEK293T cells. When we measured the background currents in HEK293T cells expressing L509S and Y578S NALCN mutants using a voltage ramp protocol, the currents in these cells were clearly larger than those in the HEK293T cells expressing only WT NALCN (Figure 5a,b). These NALCN currents were almost completely inhibited by L703606 at low concentrations (Figure 5c–e). Inhibitory doses of L703606 are similar to those of the NALCN complexes containing Src kinase (Figure 4d).
FIGURE 5.

Potent inhibition of NALCN currents by L703606 in CLIFAHDD variants (L509S and Y578S). (a) Representative current traces elicited by a voltage ramp protocol (top) in NALCN WT‐transfected, NALCN L509S‐transfected and NALCN Y578S‐transfected HEK293T cells. (b) Average current densities at −100 mV in individual groups (n = 6 for WT, n = 8 for L509S, n = 13 for Y578S. * P < .05, significantly different as indicated; one‐way ANOVA followed by Tukey's test. (c) Representative current traces elicited by the voltage ramp protocol before (control) and after application of 1‐μM L703606 or Gd3+ 100 μM in individual groups.; 1‐μM L703606 almost completely inhibited NALCN currents in both NALCN WT and its CLIFAHDD variants. (d) Average current amplitudes in the absence and presence of 1‐μM L703606 in individual groups (n = 5 for each group). The amplitudes of each current were subtracted from those of the remaining currents after Gd3+exposure. * P < .05, significantly different as indicated. (e) Concentration‐inhibition curves with IC50 in NALCN WT (n = 6), NALCN L509S (n = 5), and NALCN Y578S (n = 7)‐expressing HEK293T cells
According to an earlier study, the selectivity filter in the pore of NALCN has an EEKE (glutamate [E] and lysine [K]) motif (Lu et al., 2007). It has been considered as a mixture of the EEEE residue of voltage‐gated Ca2+ channels (CaV) and the DEKA residue of voltage‐gated Na+ channels (NaV). Therefore, in consideration of structural similarity, we next examined whether N‐benzhydryl quinuclidine compounds inhibit NaV and CaV channels. In NaV 1.5‐overexpressing and CaV 1.2 (L‐type)‐overexpressing HEK293T cells (Clatot et al., 2017; Li et al., 2014), L703606 at low concentrations (less than 10 μM) did not affect transient Na+ currents and L‐type Ba2+ currents evoked by depolarizing step pulses, but at higher doses (>10 μM) reduced them significantly. In HEK293T cells overexpressing CaV 2.1 (P‐type) (Richards et al., 2007), L703606 started to inhibit P‐type Ba2+ current from 10 μM, and the inhibitory effect was maximal at 50 μM (Figure S5a, c). To further confirm the effects of L703606 in NaV and CaV channels of real neurons, we used acutely dissociated substantia nigra pars compacta (SNc) dopaminergic neurons from TH‐eGFP mice (Jang et al., 2014; Jang et al., 2015). Up to 10 μM, L703606 did not affect NaV and CaV currents induced by depolarizing step pulses, but it significantly suppressed them at higher concentrations (Figure S5b–d). Given that native SNc dopaminergic neurons abundantly express many types of CaV channels (Cardozo & Bean, 1995; Choi, Kim, Uhm, & Park, 2003), L703606 up to 10 μM could be safely used to inhibit NALCN channels selectively (Figure S5b–d).
3.6. N‐benzhydryl quinuclidine compounds suppress neurotensin‐induced NALCN currents and hyperpolarize the membrane potential in midbrain dopaminergic neurons
In midbrain dopaminergic neurons and hippocampal neurons, NALCN is reported to carry the basal Na+ leak current that determines RMP (Lu et al., 2007; Ren, 2011). In addition, peptide neurotransmitters such as substance P and neurotensin are known to activate the NALCN channel (Lu, Su, Wang, Wang, & Ren, 2009; Shi et al., 2016; Yeh et al., 2017). Therefore, we finally assessed whether N‐benzhydryl quinuclidine compounds block NALCN currents in native SNc dopaminergic neurons. A short pulse of neurotensin to the isolated dopaminergic neurons expressing endogenous NALCN generated inward Na+ currents at a holding potential of −60 mV (Figure 6a,b). However, repeated stimulation with neurotensin did not induce responses in the native dopaminergic neuron but rather induced strong desensitization. This result may be attributed to the reduced activity of neurotensin (NTS) receptors and/or the NALCN complex itself (Donato, Cusack, Yamada, & Richelson, 1993; Hermans & Meloteaux, 1998). This neurotensin‐evoked inward current in dopaminergic neurons was not only TTX‐resistant, but also Gd3+‐sensitive and was eliminated by substitution of Na+ with NMDG (Figure 6a). These results are similar to those of the previously reported NALCN current in central neurons (Lu et al., ; Lu, Su, Wang, Wang, & Ren, 2009). In our study, PP1 suppressed the neurotensin‐induced inward currents but failed to reduce basal Na+ leak currents (Figure 6a). In contrast, L703606 (10 μM) inhibited both neurotensin‐induced Na+ currents and basal Na+ leak currents (Figure 6c–e) and hyperpolarized the membrane potential (Figure 6f,g). In this experiment, to eliminate unwanted interference of NaV and hyperpolarization‐activated cation current (Ih, HCN), dopaminergic neurons were pretreated with TTX and the HCN blocker ZD7288. The results indicate that L703606 inhibits both the constitutively active Na+ leak current and the neurotensin‐activated inward current. Taken together, we can conclude that low concentrations of N‐benzhydryl quinuclidine compounds could be used as potent direct inhibitors for NALCN channels.
FIGURE 6.

The effects of L703606 on NALCN currents and membrane potential in midbrain dopamine neurons. (a) NALCN mRNA was observed in isolated dopamine neurons (bottom left). A transmitted light image of an isolated dopamine neuron showing GFP expression (bottom right). neurotensin (NT, 10 μM) activated NALCN currents. This current was completely abolished by replacement of Na+ with equimolar NMDG and was strongly suppressed by PP1 (20 μM) and Gd3+ (10 μM). Note that the basal leak current was markedly reduced by NMDG but not by PP1. (b) Average current amplitudes of neurotensin‐activated Na+ currents at −60 mV (n = 18 for control, n = 6 for NMDG and PP1, n = 5 for Gd3+. * P < .05, significantly different as indicated; one‐way ANOVA followed by Tukey's test. (c–e) Both neurotensin‐evoked current (n = 19 for control, n = 6 for L703606, one‐way ANOVA) and basal leak current (n = 12 for control, n = 7 for L703606, Student's t‐test) were inhibited by L703606 (10 μM). * P < .05, significantly different as indicated. (f) L703606 (10 μM) hyperpolarized the membrane potential of the native dopamine neuron. (g) Scatter plots of the hyperpolarized values of membrane potentials by 5 μM (n = 7, 9.31 ± 0.92 mV) and 10‐μM L703606 (n = 6, 9.36 ± 1.2 mV). n.s., not significant
4. DISCUSSION
All kinds of cells exhibit various levels of a RMP which is largely determined by basally active leak channels that allow Na+, Ca2+, and K+ to leak down their concentration gradients (Hille, 2019; Hodgkin, 1951). Because the Na+ leak current is known to determine the RMP more than EK and, therefore, controls excitability of a neuron, the molecular counterpart NALCN, as the third branch of the voltage‐gated Na+ and Ca2+ channel family, is fundamentally important in overall neuronal physiology (Cochet‐Bissuel, Lory, & Monteil, 2014; Flourakis et al., 2015; Lu et al., 2007; Lu et al., 2010; Lutas et al., 2016; Ren, 2011; Shi et al., 2016; Snutch & Monteil, 2007). Given the many critical and fundamental questions about the nature and role of NALCN as the primary Na+ leak channel, the lack of specific pharmacological tools has hampered further investigation of this channel. To date, Gd3+ and SFKs inhibitors have been used as blockers of NALCN channels, despite their non‐specificity and even indirect actions, as in the latter case (Lu et al., 2007; Ren, 2011). In our present results, we provide clear evidence that compounds containing the N‐benzhydryl quinuclidine structure can be used as potent and reversible inhibitors of NALCN channels.
Previous studies have shown that, even though NALCN itself is the channel pore‐forming protein, it forms a large channel complex that includes UNC80, UNC79, NLF‐1, SFK, and several GPCRs (Cochet‐Bissuel, Lory, & Monteil, 2014; Lu, Su, Wang, Wang, & Ren, 2009; Lu et al., 2010). NALCN interacts directly with UNC80, which is associated with UNC79. UNC79 plays a role in the trafficking and stability of UNC80. These two proteins together seem to modulate neuronal localization and/or stabilization of the NALCN channel complex (Humphrey et al., 2007; Jospin et al., 2007; Lear et al., 2013; Yeh et al., 2008). SFK is also recruited to UNC80 and then phosphorylates NALCN and UNC80 to activate NALCN channels in central neurons (Wang & Ren, 2009). However, in heterologous recombinant systems, M3 receptor‐mediated NALCN currents appear to be reconstituted without addition of UNC80 and SFK because of the direct interaction or close co‐assembly between the intracellular segment of NALCN and the intracellular loop of the M3 receptor within the complex (Swayne et al., 2009). In agreement with this report, M3 receptor‐meditated NALCN currents were reproduced in our HEK293T cells without addition of UNC80, UNC79, and SFK. In the HEK293T cells overexpressing NALCN, NALCN complexes appear to be present as two forms: the NALCN complexes containing endogenous SFK and those lacking SFK. Carbachol seems to activate both types of complexes in our HEK293T cells. Because NALCN‐overexpressing cells may not contain sufficient endogenous SFK to form all NALCN complexes, some of the NALCN complexes may not include SFK. Therefore, if we presume that PP1 affects NALCN channel activity only through SFK, the inhibitory action of PP1 could be ascribed to NALCN complexes containing SFK. For this reason, PP1 was able to inhibit carbachol‐activated current in WT and NALCN and Src kinase expressing HEK293T cells more strongly than in NALCN‐overexpressing HEK293T cells. Because PP1 did not completely inhibit the carbachol‐induced current, SFK may not be essential for NALCN channel activation. This conclusion can be further supported by two other findings: (1) carbachol is able to evoke substantially large NACLN currents in the presence of PP1, and (2) an SFK activator cannot generate detectable inward currents in HEK293T cells overexpressing NALCN. However, because PP1 substantially inhibited carbachol‐ or neurotensin‐evoked NALCN currents, SFK seems to be necessary for proper full activation of the channels. Considering the very different current activation kinetics and desensitization courses between the HEK293T cells and SNc dopaminergic neurons, it is also possible that the NALCN channel complexes may be functionally different between these two types of cells. In agreement with this interpretation, GPCR‐activated currents, but not basal leak activity, were clearly evident in non‐neuronal HEK293T cells, while both Na+ leak currents and GPCR‐activated currents were evident in SNc dopaminergic neurons. Nevertheless, L703606 blocks all of the currents. In agreement with these results, no basal leak activity has been reported in NACLN channels of MIN6 cells and HEK293 cells co‐expressing M3 receptors and NALCN (Swayne et al., 2009). The properties of NALCN complexes in non‐neuronal cells may therefore differ from those in neurons. Another possible explanation is that constitutive activation of GPCRs in neurons constantly produces leak channel activity (Ango et al., 2001; Milligan, 2003; Swayne et al., 2009). Alternatively, channel complexes or properties may differ simply due to differing gene expressions of different cell types under their respective culture procedures (Thomas & Smart, 2005). Accordingly, further experiments are needed to elucidate the differences of NALCN complexes between neuronal cells and non‐neuronal cells and the exact role of SFK in NALCN complexes.
In neurons, it has been postulated that Na+‐dependent co‐transporters (Komendantov, Cressman, & Barreto, 2010), HCN channels (Robinson & Siegelbaum, 2003), persistent Na+ currents via voltage‐gated Na+ channels (NaV) (Crill, 1996; Khaliq & Bean, 2010), and voltage‐independent Na+ leak conductance through non‐selective cation channels (Atherton & Becan, 2005; Eggermann et al., 2003; Jones, 1989; Khaliq & Bean, 2010) are responsible for background Na+ permeability. Of these, the constitutively active Na+ leak current has been reported to play a major role in generation and maintenance of rhythmic activity of respiration (Jackson, Yao, & Bean, 2004; Raman, Gustafson, & Padgett, 2000; Russo, Mugnaini, & Martina, 2007). Considering that mutations of the NALCN gene in mice cause postnatal lethality within 24 h of birth due to abnormal respiratory activity and disruption of rhythmic behaviours, NALCN channels appear to play a key role in regulation of basal activity and excitability of many neuronal cells (Kim et al., 2012; Köroğlu et al., 2013; Lu et al., 2007; Shi et al., 2016). Moreover, activity of NALCN channels can be either enhanced or reduced by several different GPCRs, such as NK1, NTS1, M3 and Ca2+‐sensing receptors (Lu, Su, Wang, Wang, & Ren, 2009; Lu et al., 2010; Swayne et al., 2009). Therefore, NALCN channels appear to play a broad but fundamental role in many cells of the CNS. Given the importance of background Na+ permeability in neurons and many other excitable cells, it is also noteworthy that the novel N‐benzhydryl quinuclidine blockers of NALCN channels did not affect TRPC channels, which are considered important additional candidate sources of background Na+ leak current. L703606 did not affect the M3 receptor‐mediated TRPC currents in the recombinant systems we tested. These results will increase the utility of N‐benzhydryl quinuclidine compounds as NALCN channel blockers. However, L703606 at high concentrations inhibited NaV and CaV currents in the recombinant HEK293T cells and natural dopaminergic neurons. But L703606 at relatively low concentrations potently inhibited not only NALCN currents in HEK293T cells expressing M3 receptors, NALCN, UNC80, and Src529 kinase or CLIFAHDD mutants but also both constitutive Na+ leak currents and neurotensin‐evoked currents in native dopaminergic neurons. Only in the HEK293T cells minimally expressing M3 receptors and NALCN, carbachol‐evoked NALCN currents were inhibited by high concentrations of L703606.
In summary, we have demonstrated that compounds containing the N‐benzhydryl quinuclidine structure, including L703606, strongly inhibit NALCN channels. The common N‐benzhydryl quinuclidine structure, diphenylmethyl‐N‐azabicyclo (2.2.2) octan‐3‐amine appears to play a key role in inhibition of NALCN channels. Although SFK is an important component in NALCN complexes, N‐benzhydryl quinuclidine compounds inhibit NALCN channels reversibly and potently without affecting SFK activities. Therefore, N‐benzhydryl quinuclidine compounds could be very powerful tools to facilitate investigations into functions and roles of NALCN channels.
AUTHOR CONTRIBUTIONS
M.K.P., S.H., and H.J.K. conceptualized and designed the manuscript; S.H., S.W.K., K.B.U., and H.J.K. were responsible for the methodology and analysis; S.H., S.W.K., and K.B.U. contributed in the investigation; S.H. wrote the original draft; S.H., H.J.K., and M.K.P. reviewed and edited the manuscript; and H.J.K. and M.K.P were responsible for the supervision.
CONFLICT OF INTEREST
The authors declare no conflicts of interest.
DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR
This declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for Design & Analysis, Immunoblotting and Immunochemistry, and Animal Experimentation and recommended by funding agencies, publishers, and other organizations engaged with supporting research.
Supporting information
Figure S1. Knockdown of NALCN abolishes CCh‐activated current in HEK293T cells expressing M3R. (A) Comparison of endogenous NALCN mRNA (upper panel) and protein (bottom panel) expression in the absence and presence of siRNAs. (B) CCh (100 μM) induced a very small or no current in NALCN siRNA‐expressing cells compared to control HEK‐293 T cells. The current was measured at ‐80 mV. (C) Summary of the knockdown effects of NALCN‐siRNAs on the CCh‐evoked current (n = 11 for WT‐HEK293T, n = 9 for scramble control, n = 6 for NALCN siRNA‐1 and siRNA‐2, one‐way ANOVA). Nearcomplete inhibition of the current by NALCN‐siRNA2 indicates that the CCh‐activated current primarily flows through NALCN channels. *Significant difference with P < 0.05
Figure S2. Properties of CCh‐activated currents in M3R‐expressing and M3R and NALCN‐coexpressing HEK‐293T cells. CCh (100 μM)‐induced NALCN currents were measured with step‐voltage protocols (from ‐80 to 0 mV for 200 ms). These currents were sensitive to NMDG substitution and Gd3+ (100 μM), but not to TTX (0.5 μM) in M3Rexpressing HEK293T cells (n=5 for each group) (a) and in M3R and NALCN‐coexpressing HEK293T cells (n=6 for each group) (b). I‐V relationships obtained by values based on the currents generated by respective step voltages. Dashed lines indicate the zero current level.
Figure S3. L703606 inhibits CCh‐activated NALCN current in an SFK‐independent manner. CCh‐evoked whole‐cell NALCN current was measured at a holding potential of ‐80 mV in M3R and NALCN‐coexpressing HEK293T cells. (a) Pretreatment with L703606 (50 μM) completely inhibited the CCh (100 μM)‐induced current, but CCh again evoked the current after washout of L703606. (b) PP1 (50 μM) did not completely abolish the CCh‐evoked current, but further application of L703606 abolished it completely. (c) Summary of average current amplitudes of the CCh‐activated inward current with or without L703606 (n=5, Students t‐test). (d) Dialysis of an SFK activator (1μM) with a patch pipette did not activate NALCN leak currents, but, after that, CCh can still activate the current. Note that PP1 did not strongly inhibit the current in comparison with L703606. (e). Average CChinduced current densities after dialysis of an SFK activator in M3R‐expressing (n=8) and M3R and NALCN‐coexpressing HEK‐293T cells (n=5, one‐way ANOVA). (f) Summary of PP1‐mediated inhibition of CCh‐activated current (ICCh) in the absence and presence of an SFK activator in a patch pipette (n=9 for control, n=6 for Src activator, one‐way ANOVA). *Significant difference with P< 0.05, n.s= no significant.
Figure S4. L703606 does not inhibit M3R‐mediated TRPC currents. CCh (100 μM)‐induced whole‐cell TRPC currents were measured in HEK‐293T cells expressing M3R together with TRPC3 (a), TRPC4 (b), TRPC5 (c), TRPC6 (d), or TRPC7 (e). Repetitive application of CCh gradually decreased the TRPC currents. In all cases, L703606 (50 μM) did not affect M3R‐mediated TRPC currents. (F) Current ratios in cells expressing individual TRPC channel are depicted in a‐e (n=5 for each group). The normalized second responses by the first responses were used for comparison (2peak/1peak). *Significant difference with P< 0.05, n.s= no significant by one‐way ANOVA.
Figure S5. Inhibition of both voltage‐dependent Na + currents and Ca 2+ currents by L703606 at high concentrations in Nav‐ or Cav‐transfected HEK293T cells and in native mouse SNc dopamine neurons. (a) L703606 less than 10 μM did not affect both Na+ currents in NaV 1.5‐transfected HEK293T cells and L‐type Ba2+ current in CaV 1.2‐ transfected HEK293T cells, but L703606 more than 10 μM significantly inhibited them. L703606 at 10 μM mildly suppressed P‐type Ba2+ current in CaV 2.1‐transfected HEK293T cells. (b) In SNc dopamine neurons isolated from mice, L703606 less than 10 μM did not affect NaV and CaV currents significantly, but it at higher concentrations inhibited both NaV and CaV currents. (c) Dose‐response curves for L703606 with IC50 values of individual groups (HEK293T cells; n=6 for NaV 1.5 and CaV 2.1, n=5 for CaV 1.2 and M3R, NALCN, UNC80 and Src529, mouse SNc dopamine neurons; n=6 for NaV and CaV). (d) Comparison of the normalized current amplitudes after application of 10 μM L703606 in NaV and CaV in the over‐expressed HEK293T cells and mouse SNc dopamine neurons (n=5 for each group). *Significant difference with P < 0.05 (one‐way ANOVA).
ACKNOWLEDGEMENTS
This study was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. 2017R1A2B3005656).
Hahn S, Kim SW, Um KB, Kim HJ, Park MK. N‐benzhydryl quinuclidine compounds are a potent and Src kinase‐independent inhibitor of NALCN channels. Br J Pharmacol. 2020;177:3795–3810. 10.1111/bph.15104
Contributor Information
Hyun Jin Kim, Email: kimhyunjin@skku.edu.
Myoung Kyu Park, Email: mkpark@skku.edu.
REFERENCES
- Alexander, S. P. H. , Christopoulos, A. , Davenport, A. P. , Kelly, E. , Mathie, A. , Peters, J. A. , … Pawson, A. J. (2019). THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: G protein‐coupled receptors. British Journal of Pharmacology, 176(S1), S21–S141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alexander, S. P. H. , Fabbro, D. , Kelly, E. , Mathie, A. , Peters, J. A. , Veale, E. L. , … Sharman, J. L. (2019). THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Enzymes. British Journal of Pharmacology, 176(S1), S297–S396. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alexander, S. P. H. , Mathie, A. , Peters, J. A. , Veale, E. L. , Striessnig, J. , Kelly, E. , … Sharman, J. L. (2019). THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology, 176(S1), S142–S228. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alexander, S. P. H. , Roberts, R. E. , Broughton, B. R. S. , Sobey, C. G. , George, C. H. , Stanford, S. C. , … Ahluwalia, A. (2018). Goals and practicalities of immunoblotting and immunohistochemistry: A guide for submission to the British Journal of Pharmacology. British Journal of Pharmacology, 175, 407–411. 10.1111/bph.14112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ango, F. , Prézeau, L. , Muller, T. , Tu, J. C. , Xiao, B. , Worley, P. F. , … Fagni, L. (2001). Agonist‐independent activation of metabotropic glutamate receptors by the intracellular protein Homer. Nature, 411, 962–965. 10.1038/35082096 [DOI] [PubMed] [Google Scholar]
- Atherton, J. F. , & Becan, M. D. (2005). Ionic mechanisms underlying autonomous action potential generation in the somata and dendrites of GABAergic substantia nigra pars reticulate neurons in vitro. The Journal of Neuroscience, 25, 8272–8281. 10.1523/JNEUROSCI.1475-05.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Beck, B. , Zholos, A. , Sydorenko, V. , Roudbaraki, M. , Lehen'kyi, V. , Bordat, P. , … Skryma, R. (2006). TRPC7 is a receptor‐operated DAG‐activated channel in human keratinocytes. The Journal of Investigative Dermatology, 126, 1982–1993. 10.1038/sj.jid.5700352 [DOI] [PubMed] [Google Scholar]
- Bouasse, M. , Impheng, H. , Servant, Z. , Lory, P. , & Monteil, A. (2019). Functional expression of CLIFAHDD and IHPRF pathogenic variants of the NALCN channel in neuronal cells reveals both gain‐ and loss‐of‐function properties. Scientific Reports, 9, 11791 10.1038/s41598-019-48071-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cardozo, D. L. , & Bean, B. P. (1995). Voltage‐dependent calcium channels in rat midbrain dopaminergic neurons: modulation by dopaminergic and GABAB receptors. Journal of Neurophysiology, 74, 1137–1148. 10.1152/jn.1995.74.3.1137 [DOI] [PubMed] [Google Scholar]
- Cascieri, M. A. , Ber, E. , Fong, T. M. , Sadowski, S. , Bansal, A. , Swain, C. , … Strader, C. D. (1992). Characterization of the binding of a potent, selective, radioiodinated antagonist to the human neurokinin‐1 receptor. Molecular Pharmacology, 42, 458–463. [PubMed] [Google Scholar]
- Choi, Y. M. , Kim, S. H. , Uhm, D. Y. , & Park, M. K. (2003). Glutamate‐mediated [Ca2+]c dynamics in spontaneously firing dopaminergic neurons of the rat substantia nigra pars compacta. Journal of Cell Science, 116, 2665–2675. 10.1242/jcs.00481 [DOI] [PubMed] [Google Scholar]
- Clatot, J. , Hoshi, M. , Wan, X. , Liu, H. , Jain, A. , Shinlapawittayatorn, K. , … Ha, T. (2017). Voltage‐gated sodium channels assemble and gate as dimers. Nature Communications2077, 8(1), 1–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cochet‐Bissuel, M. , Lory, P. , & Monteil, A. (2014). The sodium leak channel, NALCN, in health and disease. Frontiers in Cellular Neuroscience, 8, 132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Crill, W. E. (1996). Persistent sodium current in mammalian central neurons. Annual Review of Physiology, 58, 349–362. 10.1146/annurev.ph.58.030196.002025 [DOI] [PubMed] [Google Scholar]
- Curtis, M. J. , Alexander, S. , Cirino, G. , Docherty, J. R. , George, C. H. , Giembycz, M. A. , … Ahluwalia, A. (2018). Experimental design and analysis and their reporting II: Updated and simplified guidance for authors and peer reviewers. British Journal of Pharmacology, 175, 987–993. 10.1111/bph.14153 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Donato, D. P. , Cusack, B. , Yamada, M. , & Richelson, E. (1993). Desensitization and down‐regulation of neurotensin receptors in murine neuroblastoma clone N1E‐115 by [D‐Lys8] neurotensin (8‐13). The Journal of Pharmacology and Experimental Therapeutics, 264, 1–5. [PubMed] [Google Scholar]
- Eggermann, E. , Bayer, L. , Serafin, M. , Saint‐Mleux, B. , Bernheim, L. , Machard, D. , … Mühlethaler, M. (2003). The weak‐promoting hypocretinorexin neurons are in an intrinsic state of membrane depolarization. The Journal of Neuroscience, 23, 1557–1562. 10.1523/JNEUROSCI.23-05-01557.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Flourakis, M. , Kula‐Eversole, E. , Hutchison, A. L. , Han, T. H. , Aranda, K. , Moose, D. L. , … Ren, D. (2015). A conserved bicycle model for circadian clock control of membrane excitability. Cell, 162, 803–848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harding, S. D. , Sharman, J. L. , Faccenda, E. , Southan, C. , Pawson, A. J. , Ireland, S. , … NC‐IUPHAR . (2018). The IUPHAR/BPS Guide to PHARMACOLOGY in 2018: updates and expansion to encompass the new guide to IMMUNOPHARMACOLOGY. Nucleic Acids Res., 46, D1091–D1106. 10.1093/nar/gkx1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hermans, E. , & Meloteaux, J. M. (1998). Mechanisms of regulation of neurotensin receptors. Pharmacology & Therapeutics, 79, 89–104. 10.1016/S0163-7258(98)00009-6 [DOI] [PubMed] [Google Scholar]
- Hille, B. (2001). Ion channels of excitable membranes (Third ed.). Sunderland, MA: Sinauer Associates, Inc. [Google Scholar]
- Hodgkin, A. L. (1951). The ionic basis of electrical activity in nerve and muscle. Biological Reviews, 26, 339–409. 10.1111/j.1469-185X.1951.tb01204.x [DOI] [Google Scholar]
- Humphrey, J. A. , Hamming, K. S. , Thacker, C. M. , Scott, R. L. , Sedensky, M. M. , Snutch, T. P. , … Nash, H. A. (2007). A putative cation channel and its novel regulator: Cross‐species conservation of effects on general anesthesia. Current Biology, 17, 624–629. 10.1016/j.cub.2007.02.037 [DOI] [PubMed] [Google Scholar]
- Jackson, A. C. , Yao, G. L. , & Bean, B. P. (2004). Mechanism of spontaneous firing in dorsomedial suprachiasmatic nucleus neurons. The Journal of Neuroscience, 24, 7985–7998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jang, J. , Um, K. B. , Jang, M. , Kim, S. H. , Cho, H. , Chung, S. , … Park, M. K. (2014). Balance between the proximal dendritic compartment and the soma determines spontaneous firing rate in midbrain dopaminergic neurons. The Journal of Physiology, 593, 2829–2844. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jang, M. , Um, K. B. , Jang, J. , Kim, H. J. , Cho, H. , Chung, S. , & Park, M. K. (2015). Coexistence of glutamatergic spine synapses and shaft synapses in substantia nigra dopaminergic neurons. Scientific Reports, 5, 14773 10.1038/srep14773 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jeon, J. P. , Hong, C. , Park, E. J. , Jeon, J. H. , Cho, N. H. , Kim, I. G. , … So, I. (2012). Selective G subunits as novel direct activators of transient receptor potential canonical (TRPC4) and TRPC5 channels. The Journal of Biological Chemistry, 287, 17029–17039. 10.1074/jbc.M111.326553 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jones, S. W. (1989). On the resting potential of isolated frog sympathetic neurons. Neuron, 3, 153–161. 10.1016/0896-6273(89)90028-7 [DOI] [PubMed] [Google Scholar]
- Jospin, M. , Watanabe, S. , Joshi, D. , Young, S. , Hamming, K. , Thacker, C. , … Schuske, K. (2007). UNC‐80 and the NCA ion channels contribute to endocytosis defects in synaptojanin mutants. Current Biology, 17, 1595–1600. 10.1016/j.cub.2007.08.036 [DOI] [PubMed] [Google Scholar]
- Khaliq, Z. M. , & Bean, B. P. (2010). Pacemaking in dopaminergicrgic ventral tegmental area neurons: Depolarizing drive from background and voltage‐dependent sodium conductances. The Journal of Neuroscience, 30, 7401–7413. 10.1523/JNEUROSCI.0143-10.2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kilkenny, C. , Browne, W. , Cuthill, I. C. , Emerson, M. , & Altman, D. G. (2010). Animal research: Reporting in vivo experiments: the ARRIVE guidelines. British Journal of Pharmacology, 160, 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim, B. J. , Chang, I. Y. , Choi, S. , Jun, J. Y. , Jeon, J. H. , Xu, W. X. , … So, I. (2012). Involvement of Na+‐leak channel in substance P‐induced depolarization of pacemaking activity in interstitial cells of Cajal. Cellular Physiology and Biochemistry, 29, 501–510. 10.1159/000338504 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Komendantov, A. O. , Cressman, J. R. Jr. , & Barreto, E. (2010). Ion concentration homeostasis and the regulation of neuronal firing activity: the role of cation‐chloride cotransporters. BMC Neuroscience, 11(Suppl 1), P27 10.1186/1471-2202-11-S1-P27 [DOI] [Google Scholar]
- Köroğlu, C. , Seven, M. , & Tolun, A. (2013). Recessive truncating NALCN mutation in infantile neuroaxonal dystrophy with facial dysmorphism. Journal of Medical Genetics, 50, 515–520. 10.1136/jmedgenet-2013-101634 [DOI] [PubMed] [Google Scholar]
- Lear, B. C. , Darrah, E. J. , Aldrich, B. T. , Gebre, S. , Scott, R. L. , Nash, H. A. , & Allada, R. (2013). UNC79 and UNC80, putative auxiliary subunits of the NARROW ABDOMEN ion channel, are in dispensable for robust circadian locomotor rhythms in Drosophila . PLoS ONE, 8, e78147 10.1371/journal.pone.0078147 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee, J. H. , Cribbs, L. L. , & Perez‐Reyes, E. (1999). Cloning of a novel four repeat protein related to voltage‐gated sodium and calcium channels. FEBS Letters, 445, 231–236. 10.1016/S0014-5793(99)00082-4 [DOI] [PubMed] [Google Scholar]
- Lee, Y. M. , Kim, B. J. , Kim, H. J. , Yang, D. K. , Zhu, M. H. , Lee, K. P. , … Kim, K. W. (2003). TRPC5 as a candidate for the nonselective cation channel activated by muscarinic stimulation in murine stomach. Am J PhysiolGastrointest Liver Physiol, 284, G604–G616. 10.1152/ajpgi.00069.2002 [DOI] [PubMed] [Google Scholar]
- Li, L. , Li, D. P. , Chen, S. R. , Chen, J. , Hu, H. , & Pan, H. L. (2014). Potentiation of high voltage‐activated calcium channels by 4‐aminopyridine depends on subunit composition. Molecular Pharmacology, 86, 760–772. 10.1124/mol.114.095505 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Littleton, J. T. , & Ganetzky, B. (2000). Ion channels and synaptic organization: analysis of the Drosophila genome. Neuron, 26, 35–43. 10.1016/S0896-6273(00)81135-6 [DOI] [PubMed] [Google Scholar]
- Lu, B. , Su, Y. , Das, S. , Liu, J. , Xia, J. , & Ren, D. (2007). The neuronal channel NALCN contributes resting sodium permeability and is required for normal respiratory rhythm. Cell, 129, 371–383. 10.1016/j.cell.2007.02.041 [DOI] [PubMed] [Google Scholar]
- Lu, B. , Su, Y. , Wang, H. , Wang, Y. , & Ren, D. (2009). Peptide neurotransmitters activate a cation channel complex of NALCN and UNC‐80. Nature, 457, 741–744. 10.1038/nature07579 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lu, B. , Zhang, Q. , Wang, H. , Wang, Y. , Nakayama, M. , & Ren, D. (2010). Extracellular calcium controls background current and neuronal excitability via an UNC79‐UNC80‐NALCN cation channel complex. Neuron, 68, 488–499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lutas, A. , Lahmann, C. , Soumillon, M. , & Yellen, G. (2016). The leak channel NALCN controls tonic firing and glycolytic sensitivity of substantia nigra pars reticulate neurons. eLife, 5, e15271 10.7554/eLife.15271 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Milligan, G. (2003). Constitutive activity and inverse agonists of G‐protein coupled receptors: A current perspective. Molecular Pharmacology, 64, 1271–1276. 10.1124/mol.64.6.1271 [DOI] [PubMed] [Google Scholar]
- Raman, I. M. , Gustafson, A. E. , & Padgett, D. (2000). Ionic currents and spontaneous firing in neurons isolated from the cerebellar nuclei. The Journal of Neuroscience, 20, 9004–9016. 10.1523/JNEUROSCI.20-24-09004.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ren, D. (2011). Sodium leak channels in neuronal excitability and rhythmic behaviors. Neuron, 72, 899–911. 10.1016/j.neuron.2011.12.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Richards, K. S. , Swensen, A. M. , Lipscombe, D. , & Bommert, K. (2007). Novel CaV2.1 clone replicates many properties of Purkinje cell CaV2.1 current. The European Journal of Neuroscience, 26, 2950–2961. 10.1111/j.1460-9568.2007.05912.x [DOI] [PubMed] [Google Scholar]
- Robinson, R. B. , & Siegelbaum, S. A. (2003). Hyperpolarization activated cation currents: from molecules to physiological function. Annual Review of Physiology, 65, 453–480. 10.1146/annurev.physiol.65.092101.142734 [DOI] [PubMed] [Google Scholar]
- Rorsman, P. , & Braun, M. (2013). Regulation of insulin secretion in human pancreatic islets. Annual Review of Physiology, 75, 155–179. 10.1146/annurev-physiol-030212-183754 [DOI] [PubMed] [Google Scholar]
- Russo, M. J. , Mugnaini, E. , & Martina, M. (2007). Intrinsic properties and mechanisms of spontaneous firing in mouse cerebellar unipolar brush cells. The Journal of Physiology, 581, 709–724. 10.1113/jphysiol.2007.129106 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shi, Y. , Abe, C. , Holloway, B. B. , Shu, S. , Kumar, N. N. , Weaver, J. L. , … Bayliss, D. A. (2016). Nalcn is a “leak” sodium channel that regulates excitability of brainstem chemosensory neurons and breathing. The Journal of Neuroscience, 36, 8174–8187. 10.1523/JNEUROSCI.1096-16.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sinke, A. P. , Caputo, C. , Tsaih, S. W. , Yuan, R. , Ren, D. , Deen, P. M. , et al. (2011). Genetic analysis of mouse strains with variable serum sodium concentrations identifies the Nalcn sodium channel as a novel player in osmoregulation. Physiological Genomics, 43, 265–270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Snutch, T. P. , & Monteil, A. (2007). The sodium "leak" has finally been plugged. Neuron, 54, 505–507. [DOI] [PubMed] [Google Scholar]
- Swayne, L. A. , Mezghrani, A. , Varrault, A. , Chemin, J. , Bertrand, G. , Dalle, S. , … Monteil, A. (2009). The NALCN ion channel is activated by M3 muscarinic receptors in a pancreatic β‐cell line. EMBO Reports, 10, 873–880. 10.1038/embor.2009.125 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thakur, D. P. , Tian, J. B. , Jeon, J. , Xiong, J. , Huang, Y. , Flockerzi, V. , & Zhu, M. X. (2016). Critical roles of Gi/o proteins and phospholipase C‐δ1 in the activation of receptor‐operated TRPC4 channels. PNAS, 113, 1092–1097. 10.1073/pnas.1522294113 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thomas, P. , & Smart, T. G. (2005). HEK293 cell line: A vehicle for the expression of recombinant proteins. Journal of Pharmacological and Toxicological Methods, 51, 187–200. 10.1016/j.vascn.2004.08.014 [DOI] [PubMed] [Google Scholar]
- Tsvilovskyy, V. V. , Zholos, A. V. , Aberle, T. , Philipp, S. E. , Dietrich, A. , Zhu, M. X. , … Flockerzi, V. (2009). Deletion of TRPC4 and TRPC6 in mice impairs smooth muscle contraction and intestinal motility in vivo . Gastroenterology, 137, 1415–1424. 10.1053/j.gastro.2009.06.046 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang, H. , & Ren, D. (2009). UNC80 functions as a scaffold for Src kinases in NALCN channel function. Channels (Austin, Tex.), 3, 161–163. 10.4161/chan.3.3.8853 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yeh, E. , Ng, S. , Zhang, M. , Bouhours, M. , Wang, Y. , Wang, M. , et al. (2008). A putative cation channel, NCA‐1, and a novel protein, UNC‐80, transmit neuronal activity in C. elegans . PLoS Biology, 6, e55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yeh, S. Y. , Huang, W. H. , Wang, W. , Ward, C. S. , Chao, E. S. , Wu, Z. , … Zoghbi, H. Y. (2017). Respiratory network stability and modulatory response to substance P require Nalcn. Neuron, 94, 294–303. 10.1016/j.neuron.2017.03.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1. Knockdown of NALCN abolishes CCh‐activated current in HEK293T cells expressing M3R. (A) Comparison of endogenous NALCN mRNA (upper panel) and protein (bottom panel) expression in the absence and presence of siRNAs. (B) CCh (100 μM) induced a very small or no current in NALCN siRNA‐expressing cells compared to control HEK‐293 T cells. The current was measured at ‐80 mV. (C) Summary of the knockdown effects of NALCN‐siRNAs on the CCh‐evoked current (n = 11 for WT‐HEK293T, n = 9 for scramble control, n = 6 for NALCN siRNA‐1 and siRNA‐2, one‐way ANOVA). Nearcomplete inhibition of the current by NALCN‐siRNA2 indicates that the CCh‐activated current primarily flows through NALCN channels. *Significant difference with P < 0.05
Figure S2. Properties of CCh‐activated currents in M3R‐expressing and M3R and NALCN‐coexpressing HEK‐293T cells. CCh (100 μM)‐induced NALCN currents were measured with step‐voltage protocols (from ‐80 to 0 mV for 200 ms). These currents were sensitive to NMDG substitution and Gd3+ (100 μM), but not to TTX (0.5 μM) in M3Rexpressing HEK293T cells (n=5 for each group) (a) and in M3R and NALCN‐coexpressing HEK293T cells (n=6 for each group) (b). I‐V relationships obtained by values based on the currents generated by respective step voltages. Dashed lines indicate the zero current level.
Figure S3. L703606 inhibits CCh‐activated NALCN current in an SFK‐independent manner. CCh‐evoked whole‐cell NALCN current was measured at a holding potential of ‐80 mV in M3R and NALCN‐coexpressing HEK293T cells. (a) Pretreatment with L703606 (50 μM) completely inhibited the CCh (100 μM)‐induced current, but CCh again evoked the current after washout of L703606. (b) PP1 (50 μM) did not completely abolish the CCh‐evoked current, but further application of L703606 abolished it completely. (c) Summary of average current amplitudes of the CCh‐activated inward current with or without L703606 (n=5, Students t‐test). (d) Dialysis of an SFK activator (1μM) with a patch pipette did not activate NALCN leak currents, but, after that, CCh can still activate the current. Note that PP1 did not strongly inhibit the current in comparison with L703606. (e). Average CChinduced current densities after dialysis of an SFK activator in M3R‐expressing (n=8) and M3R and NALCN‐coexpressing HEK‐293T cells (n=5, one‐way ANOVA). (f) Summary of PP1‐mediated inhibition of CCh‐activated current (ICCh) in the absence and presence of an SFK activator in a patch pipette (n=9 for control, n=6 for Src activator, one‐way ANOVA). *Significant difference with P< 0.05, n.s= no significant.
Figure S4. L703606 does not inhibit M3R‐mediated TRPC currents. CCh (100 μM)‐induced whole‐cell TRPC currents were measured in HEK‐293T cells expressing M3R together with TRPC3 (a), TRPC4 (b), TRPC5 (c), TRPC6 (d), or TRPC7 (e). Repetitive application of CCh gradually decreased the TRPC currents. In all cases, L703606 (50 μM) did not affect M3R‐mediated TRPC currents. (F) Current ratios in cells expressing individual TRPC channel are depicted in a‐e (n=5 for each group). The normalized second responses by the first responses were used for comparison (2peak/1peak). *Significant difference with P< 0.05, n.s= no significant by one‐way ANOVA.
Figure S5. Inhibition of both voltage‐dependent Na + currents and Ca 2+ currents by L703606 at high concentrations in Nav‐ or Cav‐transfected HEK293T cells and in native mouse SNc dopamine neurons. (a) L703606 less than 10 μM did not affect both Na+ currents in NaV 1.5‐transfected HEK293T cells and L‐type Ba2+ current in CaV 1.2‐ transfected HEK293T cells, but L703606 more than 10 μM significantly inhibited them. L703606 at 10 μM mildly suppressed P‐type Ba2+ current in CaV 2.1‐transfected HEK293T cells. (b) In SNc dopamine neurons isolated from mice, L703606 less than 10 μM did not affect NaV and CaV currents significantly, but it at higher concentrations inhibited both NaV and CaV currents. (c) Dose‐response curves for L703606 with IC50 values of individual groups (HEK293T cells; n=6 for NaV 1.5 and CaV 2.1, n=5 for CaV 1.2 and M3R, NALCN, UNC80 and Src529, mouse SNc dopamine neurons; n=6 for NaV and CaV). (d) Comparison of the normalized current amplitudes after application of 10 μM L703606 in NaV and CaV in the over‐expressed HEK293T cells and mouse SNc dopamine neurons (n=5 for each group). *Significant difference with P < 0.05 (one‐way ANOVA).
