Table 2.
Clinical characteristics, identified genes, and sequence variants in the patients. M—male; F—female; RF—respiratory failure; D—dysmorphia; FH—flaccidity/hypotonia; MA—metabolic acidosis; Y—yes; N—no; AR—autosomal recessive mode of inheritance; AD—autosomal dominant mode of inheritance; XLR—X-link recessive mode of inheritance.; DNR protocol—Do Not Resuscitate protocol.
| ID/Sex | Age of Onset/Age at Testing | Main Symptoms | Rapid-WES as First-Tier/Molecular Confirmation in WES | Gene/Inheritance | Variant(s) hg38 |
Pathogenicity Verdict according to ACMG Classification (https://varsome.com) | Disease/ OMIM |
Impact on Clinical Management | Death |
|---|---|---|---|---|---|---|---|---|---|
| 1/M | 3rd/ 7th week of life |
RF; distal contractures; | N/Y |
SCO2 AR |
compound heterozygote NM_005138.3: |
Leigh syndrome/604377 | Death before diagnosis | Y | |
| chr22:050524395-C > CTGAGTCACTGCTGCATGCT c.16_17insAGCATGCAGCAGTGACTCA; p.(Arg6GlnfsTer82) |
Pathogenic | ||||||||
| chr22: 50523994-C > T c.418G > A; p.(Glu140Lys) | Pathogenic | ||||||||
| 2/M | 5th/ 8th month of life |
RF; FH; D; MA; | Y/Y |
SCO2 AR |
homozygote NM_005138.3: chr22: 50523994-C > T c.418G > A; p.(Glu140Lys) |
Pathogenic | Leigh syndrome/604377 | Palliative hospice care | Y |
| 3/M | 3rd/ 10th month of life |
RF; FH; | N/Y |
POLG AR |
homozygote NM_001126131.2: chr15:89320885-G > C c.2862C > G; p.(Ile954Met) |
Likely Pathogenic | Alpers syndrome/203700 | Palliative hospice care | Y |
| 4/F | Prenatal period/ 3rd week of life |
RF, arthrogryposis; D; | N/Y |
GBE1 AR |
compound heterozygote NM_005158.3: |
Glycogen storage disease IV - perinatal severe form (Anderson syndrome)/232500 | Death before diagnosis | Y | |
| Chr3:81648854-A > G c.691+2T > C; p.- | Pathogenic | ||||||||
| chr3:81499187-C > T c.1975G > A; p.(Gly659Arg) |
Uncertain Significance | ||||||||
| 5/F | 1st day of life/ 2nd month of life |
RF; MA; D; | N/Y |
PC AR |
compound heterozygote NM_022172.3: |
Pyruvate carboxylase deficiency/ 216150 |
Death before diagnosis | Y | |
| chr11:66866282-G > A c.1090C > T; p.(Gln364Ter) |
Pathogenic | ||||||||
| chr11:66863920-C > G c.1222G > C; p.(Asp408His) |
Pathogenic | ||||||||
| 6/M | 2nd/ 3rd month of life |
RF; D; epilepsy; brain atrophy | Y/Y |
AIFM1 XLR |
hemizygote NM_004208.3: chrX:130133411-C > G c.1350G > C; p.(Arg450Ser) |
Pathogenic | Combined oxidative phosphorylation deficiency 6/ 300816 |
Palliative care, DNR protocol | Y |
| 7/F | 4th/ 16th month of life |
RF; | Y/Y |
ABCA3 AR |
homozygote NM_001089.3: chr16:002323532-C > T c.604G > A; p.(Gly202Arg) |
Uncertain Significance | Surfactant metabolism dysfunction, pulmonary, 3 (SMPD3)/ 610921 |
Lung transplantation | N |
| 8/F | At birth/ 2nd month of life |
RF, arthrogryposis; D; FH; | N/Y |
MAGEL2 AD |
de novo NM_019066.4: chr15:23644849-C > T c.2894G > A; p.(Trp965Ter) |
Pathogenic | Schaaf-Yang syndrome/ 615547 |
symptomatic treatment, multidisciplinary care | N |
| 9/F | 1st/ 8th month of life |
FH; severe delayed psychomotor development; D; | Y/Y |
NALCN AR |
compound heterozygote NM_052867.2: |
Hypotonia, infantile, with psychomotor retardation and characteristic facies 1 (IHPRF1)/ 611549 |
symptomatic treatment, multidisciplinary care | N | |
| chr13:101111216-G > A c.2203C > T; p.(Arg735Ter) |
Pathogenic | ||||||||
| Chr13:101229388-C > A c.1626+5G > T; p- |
Uncertain Significance (note: predicted to strongly affect splicing -ADA Score 0.9997. If this is taken into account the verdict is „pathogenic”). |
||||||||
| 10/F | At birth/ 1st month of life |
RF; scleroderma; | N/Y |
ACTA1 AD |
de novo NM_001100.3: Chr1:229432567-C > A c.443G > T, p.(Gly148Val) |
Likely Pathogenic | Nemaline myopathy AD/ 161800 |
Death before diagnosis | Y |
| 11/M | Prenatal period/ 1st week of life |
scleroderma edema; | N/N | non-diagnostic | - | lack | Death before diagnosis | Y | |
| 12/M | 1st/ 9th day of live |
RF; MA; elevated alanine | Y/Y |
TRMT10C AR |
compound heterozygote NM_017819.4: |
Mitochondrial disease (Combined oxidative phosphorylation deficiency 30)/ 616974 |
Palliative care, DNR protocol | Y | |
| Chr3:101565509-T > C c.728T > C; p.(Ile243Thr) |
Uncertain Significance | ||||||||
| Chr3:101565164-C > CA c.393_3394insA; p.(Tyr132IlefsTer15) |
Likely pathogenic | ||||||||
| 13/F | At birth/ 3rd day of life |
RF; F; | N/Y |
NFASC AR |
homozygote NM_015090.3: Chr1:204984059-C > T c.2491C > T; p.(Arg831Ter) |
Pathogenic | New disorder described (Neurodevelopmental disorder with central and peripheral motor dysfunction)/ 618356 |
Palliative care, DNR protocol | Y |
| 14/M | 11th/ 11th month of life |
RF; encephalopathy; sister died earlier with similar signs; | Y/Y |
NARS1 AR |
homozygote NM_004539.4: Chr18:57606713 -A > G c.1040T > C; p.(Phe347Ser) |
Uncertain Significance | A new disease suspected/108410 | Palliative care, DNR protocol | N |
| 15/M | 1st week of life/ 4th month of life |
RF; F; D; | Y/Y |
DCAF5 AD |
de novo NM_003861.3: 14:069055385-G > C c.1301C > G; p.(Ser434Ter) |
Pathogenic | A new disease suspected/603812 | Palliative care, DNR protocol | Y |
| 16/M | 2nd/ 7th day of life |
Hyperammonemia; RF; | Y/N | non-diagnostic | - | lack | Death before diagnosis | Y | |
| 17/M | Prenatal period/ 1st month of life |
General eodema; seizures; | N/N | non-diagnostic | - | lack | Death before diagnosis | Y | |
| 18/M | 2nd/ 8th month of life |
Psychomotor delay, severe deterioration of general condition | Y/Y |
SCO2 AR |
homozygote NM_005138.3: chr22: 50523994-C > T c.418G > A; p.(Glu140Lys) |
Pathogenic | Leigh syndrome/604377 | Palliative hospice care | Y |