KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse anti-β-actin	Sigma-Aldrich	Cat# A1978, RRID:AB_476692
Mouse anti-CPT1A	Abcam	Cat# ab128568, RRID:AB_11141632
Mouse anti-E-cadherin	BD Biosciences	Cat# 610181, RRID:AB_397580
Mouse anti-FLAG®	Sigma-Aldrich	Cat# F3165, RRID:AB_259529
Mouse anti-His-probe	Santa Cruz Biotechnology	Cat# sc-8036, RRID:AB_627727
Mouse anti-HNF4α	Santa Cruz Biotechnology	Cat# sc-374229, RRID:AB_10989766
Mouse anti-N-Cadherin	BD Biosciences	Cat# 610920, RRID:AB_2077527
Mouse anti-NK1.1	BD Pharmingen	Cat# 553165, RRID:AB_394677
Mouse anti-NQO1	Santa Cruz Biotechnology	Cat# sc-32793, RRID:AB_628036
Mouse anti-NRF2	Santa Cruz Biotechnology	Cat# sc-365949, RRID:AB_10917561
Mouse anti-phospho-Threonine	Cell Signaling Technology	Cat# 9386, RRID:AB_331239
Mouse anti-PKCλ	BD Biosciences	Cat# 610208, RRID:AB_397607
Rabbit anti-Albumin [EPR12774]	Abcam	Cat# ab192603
Rabbit anti MAP1LC3A	Cell Signaling Technology	Cat# 4599, RRID:AB_10548192
Rabbit anti-Cleaved Caspase3	Cell Signaling Technology	Cat# 9664, RRID:AB_2070042
Rabbit anti-GFP	Cell Signaling Technology	Cat# 2956, RRID:AB_1196615
Rabbit anti-HA-Tag	Cell Signaling Technology	Cat# 3724, RRID:AB_1549585
Rabbit anti-Ki-67	Abcam	Cat# ab16667, RRID:AB_302459
Rabbit anti-PARP-1	Santa Cruz Biotechnology	Cat# sc-7150, RRID:AB_2160738
Rabbit anti-Phospho MAP1LC3A(S12)	Abgent	Cat# AP3301a, RRID:AB_2137560
Rabbit anti-PKCz	Cell Signaling Technology	Cat# 9368, RRID:AB_10693777
Rabbit anti-Snail	Cell Signaling Technology	Cat# 3879, RRID:AB_2255011
Rabbit anti-SQSTM1/p62	Thermo Fisher Scientific	Cat# PA5–20839, RRID:AB_11157045
Rabbit anti-Thiophosphate ester	Abcam	Cat# ab92570, RRID:AB_10562142
Rabbit anti-V5 tag	Thermo Fisher Scientific	Cat# PA1–993, RRID:AB_561893
Rabbit anti-ZEB1	Santa Cruz Biotechnology	Cat# sc-25388, RRID:AB_2217979
Rat anti-B220 (CD45R)	Thermo Fisher Scientific	Cat# 14-0452-82, RRID:AB_467254
Rat anti-B220 (CD45R)	BD Pharmingen	Cat# 552771, RRID:AB_394457
Hamster anti-CD3	D Biosciences	Cat# 550275, RRID:AB_393572
Hamster anti-TCRβ chain	BD Pharmingen	Cat# 553174, RRID:AB_398534
Armenian hamster anti-TCRβ chain	eBioscience	Cat# 45–5961, RRID:AB_925764
Armenian hamster anti-CD11c	BD Pharmingen	Cat# 558079, RRID:AB_647251
Rat anti-CD16/CD32	BD Pharmingen	Cat# 553142, RRID:AB_394657
Rat anti-CD4	BD Horizon	Cat# 560468, RRID:AB_1645271
Rat anti-CD8	BD Pharmingen	Cat# 557654, RRID:AB_396769
Rat anti-CD11b	eBioscience	Cat# 47–0112, RRID:AB_1603193
Rat anti-CD45	BD Horizon	Cat# 563891, RRID:AB_2734134
Rat anti-F4/80 (IF)	Abcam	Cat# ab6640, RRID:AB_1140040
Rat anti-F4/80 (FACS)	eBioscience	Cat# 17–4801, RRID:AB_469452
Rat anti-Ly6C	BD Horizon	Cat# 560594, RRID:AB_1727559
Rat anti-Ly6G (IF)	Bio X Cell	Cat# BE0075–1, RRID:AB_1107721
Rat anti-Ly6G (FACS)	BD Pharmingen	Cat# 561236, RRID:AB_10611860
Rat anti-KRT19	DSHB	Cat# TROMA-III, RRID:AB_2133570
Rat anti-MHC class II (I-A/I-E)	eBioscience	Cat# 11–5321, RRID:AB_465232
Rat anti-PD-L1	eBioscience	Cat# 12–5982, RRID:AB_466088
Goat anti-Mouse IgG, secondary, HRP	Thermo Fisher Scientific	Cat# 31436, RRID:AB_228313
Goat anti-Mouse IgG1, secondary, HRP	Thermo Fisher Scientific	Cat# PA1–74421, RRID:AB_10988195
Goat anti-Rabbit IgG1, secondary, HRP	Thermo Fisher Scientific	Cat# 31461, RRID:AB_228347
Goat anti-Rabbit IgG, secondary, Biotin	Agilent	Cat# E0432, RRID:AB_2313609
Rat anti-Mouse IgG1, secondary, Biotin	BD Biosciences	Cat# 550331, RRID:AB_2296342
Normal mouse IgG	Santa Cruz Biotechnology	Cat# sc-2025, RRID:AB_737182
Bacterial and Virus Strains
DH5α Competent Cells	Thermo Scientific	Cat# 18265017
One Shot Stbl3 Chemically Competent	Thermo Scientific	Cat# C737303
Biological Samples
Human samples (Normal liver tissues, hepatocellular carcinomas)	Mayo Clinic, Minnesota, USA	N/A
Chemicals, Peptides, and Recombinant Proteins
2-Mercaptoethanol	Gibco	Cat# 31350010
[U-13C16]Palmitate	Cambridge Isotope	Cat# CLM-409-PK
[U-13C6]Glucose	Cambridge Isotope	Cat# CLM-1396-PK
Ampicillin	Fisher BioReagents	Cat# BP1760–25
Antimycin A	Sigma-Aldrich	Cat# A8674
B27 Supplement	Gibco	Cat# 17504001
Bafilomycin A1	Selleck Chemicals LLC	Cat# S1413
bFGF recombinant protein	Gibco	Cat# 13256029
Butylated hydroxyanisole (BHA)	Sigma-Aldrich	Cat# B1253
Collagenase type IV	Sigma-Aldrich	Cat# C5138–1G
Crystal violet solution	Sigma-Aldrich	Cat# V5265
DAPI	Life Technologies	Cat# D1306
Dexamethasone	Sigma-Aldrich	Cat# D1756
Dihydroethidium (DHE)	Sigma-Aldrich	Cat# D7008
DMEM	Corning	Cat# 10–017CV
DMEM/F-12, GlutaMAX supplement	Gibco	Cat# 10565018
ECL Western Blotting Substrate	Thermo Scientific	Cat# 32106
Etomoxir	Sigma-Aldrich	Cat# E1905
FCCP	Sigma-Aldrich	Cat# C2920
GW6471	Sigma-Aldrich	Cat# G5045
HBSS (no calcium, no magnesium)	Gibco	Cat# 14175095
HEPES	Gibco	Cat# 15630080
High Fat Calories (60%) Mouse Diet	Bio-Serv	Cat# F3282
His6_LC3/MAP1LC3A recombinant human protein	BostonBiochem	Cat# UL-430
Hygromycin B Solution	Corning	Cat# 30–240-CR
Insulin-Transferrin-Selenium (ITS)	Gibco	Cat# 41400045
L-Glutamine	Corning	Cat# 25–005-CI
Lipofectamine RNAiMAX Transfection Reagent	Invitrogen	Cat# 13778030
lonomycin	Sigma-Aldrich	Cat# I0634
Lysing Buffer	BD Pharm Lyse	Cat# 555899
Matrigel®Growth Factor Reduced (GFR) Basement Membrane Matrix	Corning	Cat# 356230
Methyl cellulose, 400 cP	Sigma-Aldrich	Cat# 0262
MultiScribe Reverse Transcriptase	Invitrogen	Cat# 4311235
Murine EGF	Gibco	Cat# PMG8045
N-Acetyl Cystein (NAC)	Sigma-Aldrich	Cat# A7250
Oil Red O 0.5% Solution in Propylene Glycol	Poly Scientific R&D Corp.	Cat# s1848
Oligomycin	Sigma-Aldrich	Cat# 75351
Opti-MEM Reduced Serum Medium	Gibco	Cat# 31985070
PBS (no calcium, no magnesium)	Gibco	Cat# 10010–023
Percoll	GE Healthcare	Cat# GE17-0891-01
Phorbolmyristate acetate	Sigma-Aldrich	Cat# P8139
PKCλ recombinant human protein	The Proteomics Core at SBP Medical Discovery Institute	N/A
Polybrene Infection Reagent	Sigma-Aldrich	Cat# TR-1003-G
Puromycin	Omega Scientific, inc.	Cat# PR-01
Quick-RNA Miniprep Kit	Zymo Research	Cat# R1054
QuickChange II Site-Directed Mutagenesis Kit	Agilent	Cat# 200523
RNAlater Stabilization Solution	Invitrogen	Cat# AM7021
Rotenone	Sigma-Aldrich	Cat# R8875
RPMI 1640 Medium, GlutaMAX supplement	Gibco	Cat# 61870036
Sirius Red, 0.1% in Saturated Picric Acid	Electron Microscopy Sciences	Cat# 50-300-77
Tissue-Tek OCT compound	Sakura Finetek USA	Cat# 4583
TRIzol	Thermo Fisher Scientific	Cat# 15596018
Trypan Blue Solution, 0.4%	Gibco	Cat# 15250061
Trypsin-EDTA (0.25%), phenol red	Gibco	Cat#25200056
X-tremeGENE HP DNA Transfection Reagent	Roche	Cat# 6366236001
Calyculin A	Sigma	Cat# C5552
Critical Commercial Assays
β-hydroxybutyrate Colorimetric Assay Kit	Cayman Chemical	Cat# 700190
Matrigel invasion assay	Corning	Cat# 354480
Mouse on Mouse (M.O.M.) Basic Kit	Vector	Cat# BMK-2202
SeaHorse Seahorse XF24 Islet Capture FluxPak	Agilent	Cat# 101174–100
Triacylglycerol quantification assay	Wako	Cat# 992–02892
VECTASTAIN® Elite(R)ABC-HRP Kit	Vector	Cat# PK-6100
VetScan Mammalian Liver Profile	Abaxis	Cat# 500–0040
Deposited Data
RNA-seq (Prkcif/f and Prkcif/fAlbCre livers)	This study; GEO	GSE147801
RNA-seq (Prkcif/f and Prkcif/fAlbCre livers under DEN/HFD protocol)	This study; GEO	GSE147801
Microarray Gene Expression (human liver tissues)	GEO	GSE10143
RNA-seq (human liver tissues)	TCGA-LIHC	UNSC Xena
Raw Data	This study; Mendeley Data	https://doi.org/10.17632/xm87k23hrh.1
Experimental Models: Cell Lines
BNL CL.2	ATCC	Cat# TIB-73, RRID:CVCL_4383
DihXD3	This study	N/A
HEK293T	ATCC	Cat# CRL-3216, RRID:CVCL_0063
HepG2	ATCC	Cat# HB-8065, RRID:CVCL_0027
Phoenix-GP	ATCC	Cat# CRL-3215, RRID:CVCL_H718
Experimental Models: Organisms/Strains
Mouse: Alb-cre	The Jackson Laboratories	Stock No: 003574
Mouse: C57BL/6	The Animal Facility Core at SBP Medical Discovery Institute	N/A
Mouse: Nfe2l2−/−	Gift from Michael Karin, Ph.D.	N/A
Mouse: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG)	The Animal Facility Core at SBP Medical Discovery Institute	N/A
Mouse: Prkcif/f	Leitges et al., 2001	N/A
Oligonucleotides
Primers, see Table S1	IDT	N/A
gRNA targeting human PRKCI gene: GCCGCCGCCTGCGACCGTGT	Synthego	N/A
gRNA targeting mouse Prkci gene: AGTCCCTCAAAGGAGATGGA	Synthego	N/A
Mouse Cpt1a siRNA	Santa Cruz Biotechnology	Cat# sc-40377
Mouse Nfe2l2 siRNA	Santa Cruz Biotechnology	Cat# sc-37049
Mouse Prkci siRNA	Thermo Fisher	Cat# 150153
Recombinant DNA
pBABE-puro-mCherry-eGFP-LC3B	Addgene	Cat# 22418
pBABE-puro-mCherry-eGFP-LC3B (T12A)	This paper	N/A
pBABE-puro-myc-BioID2	Addgene	Cat# 80900
pBABE-puro-myc-BioID2-PRKCI	This paper	N/A
pCMV-FLAG-p62	Duran et al, 2011	N/A
pCMV-FLAG-PKCλ	Reina-Campos et al., 2019b	N/A
pCMV-FLAG-PKCλ (1–250)	This paper	N/A
pCMV-FLAG-PKCλ (250–596)	This paper	N/A
pCMV-FLAG-PKCλ (D7276AA)	This paper	N/A
pCMV-FLAG-PKCλ (K274W)	This paper	N/A
pEGFP-LC3	Addgene	Cat# 24920
pCSF107mT-PPARα-HA	This paper	N/A
pLX304-V5-LC3A (S12A)	This paper	N/A
pLX304-V5-LC3A	DNAsu	HsCD00440693
pREP-8xARE-GFP-SV40-BFP	Addgene	Cat# 134910
psPAX2	Addgene	Cat# 12260
pMD2.G	Addgene	Cat# 12259
pWZL-FLAG-LC3A	This paper	N/A
pWZL-FLAG-LC3A (S12A)	This paper	N/A
Software and Algorithms
FlowJo	Tree Star Inc.	N/A
GenePattern	Broad Institute	https://cloud.genepattern.org/gp/pages/login.jsf
Graphpad Prism 8	Graphpad	https://www.graphpad.com/scientificsoftware/prism/
ImageJ	NIH	https://imagej.nih.gov/ij/
Ingenuity Pathway Analysis	QIAGEN	https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis/
NextBio	Illumina	https://www.nextbio.com/b/authentication/login.nb
R	R Core Team	https://www.r-project.org/
Scansite v4.00.022	Koch Institute	https://scansite4.mit.edu/4.0/#home
UniProt	NIH	https://www.uniprot.org/
UCSC Xena	UCSC	https://xenabrowser.net/datapages/
Other
EP-1 Econo Pump	Bio-Rad	Cat# 731–8140
EVOS FL Auto Imaging System	Thermo Fisher Scientific	N/A
EVOS XL Core Cell Imaging System	Thermo Fisher Scientific	N/A
LSRFortessa 14-colors analyzer	BD Biosciences	N/A
NanoDrop 1000 spectrophotometer	Thermo Fisher Scientific	N/A
Neon Transfection System	Thermo Fisher Scientific	MPK1096
Philips CM-100 Transmission Electron Microscope	Philips Electron Optics	N/A
TyssueLyser II	QIAGEN	Cat# 85300
Zeiss LSM 710 NLO Confocal Microscope	Carl Zeiss Microscopy	N/A
VetScan v2 Chemistry Analyzer	Abaxis	N/A