Skip to main content
NCBI home page
Iranian Journal of Veterinary Research logoLink to Iranian Journal of Veterinary Research
. 2020 Spring;21(2):120–125.

Changes in peripheral blood mononuclear cells’ mRNA expression of TLRs and CD14 during puerperal metritis in dairy cattle

R Asadpour 1,*, A Farhadi 2, R Jafari Jozani 1, A Hajibemani 1, M Tolouei Kaleibar 1
PMCID: PMC7430367  PMID: 32849891

Abstract

Background:

Peripheral blood mononuclear cells (PBMCs), commonly referred to as lymphocytes and monocytes, representing cells of the innate and adaptive immune systems.

Aims:

To find out whether changes in PBMCs’ mRNA expression of pattern recognition receptors (PRRs) are associated with puerperal metritis in Holstein cows.

Methods:‏

Peripheral blood mononuclear cells were collected from 20 cows with puerperal metritis and 20 cows without metritis at 10 days postpartum. Expression of toll-like receptors 2 and 4 (TLR2 and TLR4), and cluster of differentiation 14 (CD14) genes were assessed in PBMCs using a quantitative real time-polymerase chain reaction (qRT-PCR) technique. The data was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a reference gene, and 2-∆∆Ct methodology was used for relative quantification.

Results:

The results of the present study demonstrated that the expression of TLR4 (P=0.04) and CD14 (P=0.008) was significantly greater in cows with puerperal metritis compared to the control group. However, the expression of TLR2 (P=0.06) was not significantly different between cows with puerperal metritis and healthy cows.

Conclusion:

This study suggests that puerperal metritis significantly increases the expression of TLR4 and CD14 genes in the PBMCs which contributes to the proper stimulation of inflammation and uterine clearance of bacteria soon after calving.

Key Words: Cattle, CD14, Metritis, Toll-like receptors

Introduction

Metritis is a deep inflammation of the uterine wall with symptoms of a systemic disease. It can occur up to 21 days postpartum but often strikes in less than the first 10 days (Sheldon et al., 2006 ▶). The disease can affect huge numbers of herds and cause production losses with a negative influence on reproduction and survival (Mahnani et al., 2015 ▶; Cunha et al., 2018 ▶; Ahmadi et al., 2019 ▶). In several studies, the prevalence rate of clinical and puerperal metritis have been reported to be 36-50% and 18-21%, respectively (Reppert, 2015 ▶). As uterine diseases can affect large numbers of herds and severe economic loss, studying the molecular mechanisms of the immune response of the uterus is essential for the management of postpartum uterine infections in dairy cows (Herath et al., 2006a ▶).

Infection is known to incite inflammation when microbial pathogens are recognized by the host’s native immune system (Takeuchi and Akira, 2010 ▶). Innate immune responses may be stimulated by various forms of pattern-recognition receptors (PRRs), the most common of which are toll-like receptors (TLRs). Toll-like receptors such as TLR2 are the best types of PRRs, and play a crucial role in innate and adaptive immunity while acting as potential structures to identify the bacterial infections caused by gram bacteria (Yapan et al., 2014 ▶). An extraordinary feature of TLR2 and TLR4 is their ability to collaborate with cluster of differentiation 14 (CD14) on the host cell surface to identify lipopolysaccharides (LPS) Gram-negative bacterial infection (O’Neill et al., 2009 ▶). These immune agents identify Gram-negative bacteria through the LPS or lipid A of their cell walls and stimulate the inflammation process (Brubaker et al., 2015 ▶). Cytokines such as tumor necrosis factor-alpha (TNF-α), also lead to the migration of immune cells to the uterus and contribute to the cleaning of infections (Sheldon and Dobson, 2004 ▶).

Studies have indicated that endotoxins that are able to translocate from the uterus into the circulation increase pro-inflammatory cytokines and cause a systemic inflammatory response. Increases in the levels of LPS in the peripheral plasma causes inflammatory responses in the uterus and expression genes of pro-inflammatory cytokines (Bilal et al., 2016 ▶; Emily et al., 2016). Studies clearly revealed that several immune genes secreted into the uterine lumen enter the uterine vein and directly upregulate the expression of immune genes in both uterus and peripheral blood cells (van der Molen et al., 2014 ▶; Bilal et al., 2016 ▶; Emily et al., 2016). The upregulation of the immune gene expression in peripheral blood is a potential target for original approaches of the early diagnosis of uterine infections. The objective of this study was to identify changes in some immune gene expressions in peripheral blood mononuclear cells (PBMCs) of metritis cows, in order to identify novel disease biomarkers, and to help clarify the functional role of immunity and the inflammatory process of this infection.

Materials and Methods

Animals

A total of 40 lactating Holstein cows were selected from industrial dairy cows at the Azarnegin farm in Tabriz, East Azerbaijan province, North West of Iran. The studied cows included two groups for sampling:

1) Cows with puerperal metritis

2) Clinically healthy cows that were free of any uterine infections

In this study, 20 registered multiparous Holstein cows with metritis and 20 healthy registered multiparous Holstein cows without any uterine infections were examined. The healthy cows were those that calved normally without peripartum diseases (dystocia, retained placenta, metritis, clinical hypocalcaemia, mastitis, ketosis, and displacement of abomasum) or other diseases. All cows were kept in an open shed system, milked three times a day. The first service was performed 55 days postpartum. The body condition scores of all animals were ≥2. All cows were kept on the same environmental and management conditions.

Evaluation of puerperal metritis

The cows’ reproductive system was examined within 10 days postpartum to diagnose possible metritis. Uterine infection was determined as described by Sheldon et al. (2006) ▶. All animals that showed both defined local and systemic signs were identified as puerperal metritis. The infected cows exhibited systemic signs of illness including fever, loss of appetite, dullness and markedly reduced milk yield with a large volume of fetid, reddish fluid in their uterus within a few days of calving.

After clinical evaluation, samples were aseptically obtained from uterine contents, sent to the laboratory, and cultured for aerobic bacteria. Samples were collected by introducing sterile pipettes into the uterus. Sterile syringes were attached to the end of these pipettes. To isolate aerobic bacteria, the samples were then transferred to a tube containing Stuart medium (Koneman et al., 1971 ▶).

PBMCs separation

From all cows (n= 40), 4 ml blood was taken (at 10 days after calving) from the tail vein into tubes containing ethylenediaminetetraacetic acid (EDTA) anticoagulant. The samples were kept on ice and sent to the laboratory. Initially, the temperature of the solutions was set at 37°C in the incubator; the blood sample and phosphate buffered saline (PBS) were mixed with a ratio of 1:1 to a total volume of 4 ml and then layered on top of Lymphodex (Inno-train Diagnostic GMBH, Germany) as a density gradient for the isolation of PBMCs. The tube was centrifuged at room temperature at 300 g for 40 min. The PBMCs layer was then harvested and washed two times with PBS for 5 min at 300 g. After cell counting by hemocytometer, 5 × 106 PBMCs cells were mixed with 200 μL of Trizol solution and stored at -80°C for the next step, which was RNA extraction.

RNA extraction and cDNA synthesis

RNA extraction was performed using Accuzol solution from BIONEER (Bioneer Company, S. Korea) according to the company’s recommendations. After extraction, RNA was treated with 1 unit of DNase (Yekta Tajhiz, Iran). The quality and quantity of the extracted RNA samples were then assessed using Agilent 2200 Tapestation system (Agilent Technologies, Santa Clara, CA, USA). For cDNA synthesis, 5 μL of the extracted RNA, 1 μL of Random Hexamer Primer and 13.4 μL of diethylpyrocarbonate (DEPC) water solution were mixed and centrifuged shortly (1613 g for 30 s). The mixture was placed in the incubator for 5 min, at 70C and placed on ice later to be cooled. Four μL of 5X buffer, 1 μL of the first-strand buffer, 0.5 μL of deoxyribonucleotide triphosphate (dNTP), RNasein (40 μ/μL) and 1 μL moloney murine leukemia virus (MMLV) were added to the solution and centrifuged. The tubes were transferred into the incubator at 37°C for 60 min. In order to produce the second strand of cDNA, the product was transferred to an incubator at 70°C for 5 min. The production of cDNA was carried out using a commercial cDNA synthesis kit (YTA Company, Iran) according to the manufacturer’s guidelines.

Real time-polymerase chain reaction (RT-PCR)

The level of mRNA gene expression of TLR4, TLR2, and CD14 genes was determined by quantitative real time-polymerase chain reaction (qRT-PCR) test using the SYBR Green I in a Rotogen 6000 system (QIAGEN, Germany). Polymerase chain reaction were performed in 20 μL reaction mixture containing 1 μL cDNA, 10 μL Master mix 1x (SYBR Premix Ex Taq (2x) (YTA Company, Iran), 0.5 μL of PCR forward and reverse primers and 8 μL of dH2O (sterile distilled water). The primers (listed in Table 1 below) were designed for the target genes using Allele ID software (version 7.5).

Table 1.

Characteristics of primers used for RT-PCR

Gene Gene name Primer Nucleotide sequence (5´ → 3´) GeneBank
Accession No.
CD14 Cluster of differentiation 14 Forward AGCCCTCCAGCACCAAAATGA NM_174008.1
Reverse CAGAAGGCTGGTTGGTTGAG
TLR2 Toll-like receptors 2 Forward CATGGGTCTGGGCTGTCATC NM_174197.2
Reverse TCACACACCTCTGCAGGTCTC
TLR4 Toll-like receptors 4 Forward CAAAAAGTATGGCAGGGGCGA NM_174198.6
Reverse CCTGAGACAAGATGGTGAAGGT
GAPDH Glyceraldehyde-3-phosphate dehydrogenase Forward GCTTTTGTGGAAACCCTCCTG NM_001190390
Reverse ATGGGTGGAATCATACTGGAAC
Open in a new tab

RT-PCR: Real time-polymerase chain reaction

The PCR thermal cycling consisted of one cycle of initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing 56°C for 2 min and cyclic extension at 60°C for 1 min. All trials were analyzed in duplicate and the average values were used for quantification. Data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a reference gene, and the 2-∆∆Ct methodology was used for relative quantification.

Statistical analysis

Data achieved in this study were analyzed using the statistical software SPSS-21 (SPSS Corporation, USA).

An independent t-test was used to assess the difference of the mean cycle threshold (Ct) values of the GAPDH gene between healthy control, and puerperal metritis groups. The data obtained from RT-PCR for all target genes is presented as their relative fold change (n-fold).

Results

Bacterial isolation

Arcanobacter pyogenes, Escherichia coli, and non-differentiated streptococci, staphylococci, and bacilli were the most commonly isolated bacteria in both groups. However, A. pyogenes and E. coli bacteria were mostly isolated from the dairy cattle with puerperal metritis. The prevalence of pathogens associated with acute puerperal metritis is shown in Table 2.

Table 2.

Prevalence of pathogens associated with acute puerperal metritis

Bacteria identified Isolated from cows with metritis (n=20 samples) Isolated from cows without metritis (n=20 samples)
Streptococcus sp. 4 (20%) 3 (15%)
Bacillus 1 (5%) 1 (5%)
Escherichia coli 6 (30%) 3 (15%)
Staphylococcus aureus 4 (20%) 2 (10%)
Arcanobacterium pyogenes 5 (25%) 2 (5%)
No growth 0 (0%) 9 (45%)
Open in a new tab

Gene expression

The results of our study revealed that TLR4 gene expression was significantly greater in cows with puerperal metritis compared to the healthy control cows (P=0.04) (Fig. 1). TLR2 gene expression for cows with metritis was higher than healthy control cows in relative terms, but this increase was not significant (P>0.05) (Fig. 2). CD14 gene expression in cows with puerperal metritis was significantly higher than that of the healthy cows, (P=0.008) (Fig. 3).

Fig. 1.

Fig. 1

Open in a new tab

Expression levels of toll-like receptors 4 (TLR4) (mean±SE) in cows with metritis (TLR4 met) and healthy cows (TLR4 con). * P<0.05

Fig. 2.

Fig. 2

Open in a new tab

Expression levels of toll-like receptors 2 (TLR2) (mean±SE) in cows with metritis (TLR2 met) and healthy cows (TLR2 con)

Fig. 3.

Fig. 3

Open in a new tab

Expression levels of cluster of differentiation 14 (CD14) (mean±SE) in cows with metritis (CD14 met) and healthy cows (CD14 con). ** P<0.01

Discussion

Neutrophil function is reduced close to the time of parturition in high-producing dairy cattle (Lange et al., 2016 ▶), especially those with uterine diseases (Cai et al., 1994 ▶; KIM et al., 2005 ▶). Recent studies show the role of uterine endometrium in inflammatory response and its modulation in cattle uterine infection (Fischer et al., 2010 ▶). Previous studies have also indicated that endotoxins are able to translocate from the uterine into the systemic circulation. As a result, systemic immune responses might begin against endotoxins, which are the product of pro-inflammatory cytokines, and cause the expression of the genes associated with inflammation in the PBMCs (Bilal et al., 2016 ▶; Emily et al., 2016). In the present study, to determine the differences between the inflammatory processes of puerperal metritis and healthy cows, PBMCs gene expression was compared between infected and control cows. Highlighting the relation between uterine innate immune statues and postpartum uterine infections is vital for a good understanding of the susceptibility to or resistance against post-partum uterine infections.

Toll-like receptor 2 is critical for the recognition of Gram-positive bacteria, including anaerobes which are clinically relevant in cases of uterine inflammation (Takeuchi et al., 2000 ▶; Yoshimura et al., 2000 ▶). Toll-like receptor 2 ligands recognize pathogen-associated molecular patterns (PAMPs) from Gram-positive bacteria, as well as lipoteichoic acid, lipopeptides, and peptidoglycans (Zähringer et al., 2008 ▶). Surprisingly, we did not observe any differences in the TLR2 gene expression following uterine infection with LPS and other bacteria. These findings are in agreement with (Martins et al., 2011), who stated that the levels of TLR2 transcription did not differ between uterine biopsies of cows with uterine infection and healthy cows. Schöniger et al. (2017) ▶ demonstrated that there was no relationship between mare endometritis and the expression of TLR2. The reason for this inconsistency may rely on the fact that TLR2 is important for identifying Gram-positive bacteria, while Gram-negative bacteria are involved in the establishment of metritis. Therefore, lower TLR2 by 10 days postpartum could further compromise the leukocyte reply to bacteria attacking the uterus and lead to deficiency of recognition, hence the clearance of the bacteria.

Toll-like receptor 4 recognizes Gram-negative bacteria (Herath et al., 2006b ▶; Herath et al., 2009 ▶; Sheldon et al., 2010 ▶), such as E. coli, which is one of the most-commonly found bacteria in the uterus environment during the first weeks postpartum (Sheldon et al., 2002 ▶; Williams et al., 2005 ▶). Considering the fact that Gram-negative bacteria are often associated with acute puerperal metritis in cows, (Sheldon et al., 2010 ▶) this positive correlation can support the idea that escalated levels of TLR4 mRNA can be related to an over responsiveness to uterine bacterial colonization at early stages of the postpartum period. In the current study, the TLR4 expression for the cows with puerperal metritis increased in comparison with healthy cows. The results of this study are in agreement with Herath et al. (2009) ▶, demonstrating that persistent infections of the uterus are associated with elevated TLR4, CD14, and myeloid differentiation factor-2 (MD-2) expressions at time points during the first-week postpartum. In vitro research showed that bovine endometrial cells exposed to LPS, escalate in the expression of TLR4 and CD14 as well as the induction of the expression of chemokines and cytokines approximately 24 h after the revelation (Swangchan et al., 2012 ▶). In another study, Patra et al. (2014) claimed that TLR4 expression was higher in buffaloes with endometritis compared to healthy buffaloes. They also demonstrated that the TLR4 expression gene could be a distinguishing factor for the diagnosis of endometritis in buffaloes. Moreover (Davies et al., 2008 ▶), showed that TLR4/MD2/CD14 complex (which is due to the presence of LPS of Gram-negative bacteria) plays a key role in the secretion of prostaglandin E2 (PGE2) from epithelial cells and increases the days open of cows with endometritis. Additionally, the co-receptors CD14 and MD-2 are needed for the recognition of LPS by TLR4. The interaction of LPS and TLR4/CD14/MD-2 induces the expression of cytokines, antimicrobial peptides and chemokines and causes an inflammatory response. The lack of CD14 results in a feeble interaction between LPS and the TLR4–MD-2 complex (Triantafilou and Triantafilou, 2002 ▶; Miyake, 2006 ▶; Fu et al., 2013 ▶). Thus, once an infection in the uterus is proven, expression levels of TLRs in PBMCs could reflect a response rather than a prejudicing factor to the infection.

In the current study, the expression of CD14 increased in PBMCs cows with puerperal metritis compared to the control cows. This report is in agreement with Herath et al. (2009) ▶ who reported that uterine infections are related to escalated expression levels of CD14 and MD-2 at the first week after calving. In another study, Loyi et al. (2015) reported that the expression of CD14 increased significantly in subclinical endometritis cows compared with healthy cows. This consistency is likely due to the fact that CD14 acts as a receptor for the MD-2 complex which is activated in the presence of LPS during metritis (Takeuchi et al., 2000 ▶; Yoshimura et al., 2000 ▶). Nonetheless, the increased expression of genes linked to innate immunity or inflammation, when infection/inflammation is already established, does not provide evidence for the cause/effect relationships of these genes and the development of the infection/inflammation, because the up-regulation of these genes under the mentioned circumstances is probably a response to the infection rather than a predisposing factor.

Consequently, our findings of higher transcription levels of TLR4 and CD14 at 10 days postpartum, mostly in dairy cows with puerperal metritis, may be related to the pathogenesis of puerperal metritis even if a clear cause and effect relationship remains to be established. Our study suggests that the increased expression levels of TLR4 and CD14 genes in the PBMCs may contribute to a proper activation of the inflammation process and consequently, clear the bacteria from the uterus soon after calving.

Acknowledgements

The authors gratefully acknowledge the financial support for this research provided by the University of Tabriz. The authors also thank the Azernegin Company Farm staff for their kind collaboration.

Conflict of interest

The authors state that they do not have any conflicts of interest.

References

  1. Ahmadi M, Makki M, Mirzaei A, Gheisari H. Effects of hypertonic dextrose and paraffin solution as non- antibiotic treatments of clinical endometritis on reproductive performance of high producing dairy cows. Reprod. Domest. Anim. 2019;54:762–771. doi: 10.1111/rda.13424. [DOI] [PubMed] [Google Scholar]
  2. Bilal MS, Abaker JA, Aabdin ZU, Xu T, Dai H, Zhang K, Liu X, Shen X. Lipopolysaccharide derived from the digestive tract triggers an inflammatory response in the uterus of mid-lactating dairy cows during SARA. BMC Vet. Res. 2016;12:284–293. doi: 10.1186/s12917-016-0907-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brubaker SW, Bonham KS, Zanoni I, Kagan JC. Innate immune pattern recognition: a cell biological perspective. Annu. Rev. Immunol. 2015;33:257–290. doi: 10.1146/annurev-immunol-032414-112240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cai TQ, Weston P, Lund L, Brodie B, McKenna D, Wagner W. Association between neutrophil functions and periparturient disorders in cows. Am. J. Vet. Res. 1994;55:934–943. [PubMed] [Google Scholar]
  5. Cunha F, Jeon SJ, Daetz R, Vieira-Neto A, Laporta J, Jeong KC, Barbet AF, Risco CA, Galvao KN. Quantifying known and emerging uterine pathogens, and evaluating their association with metritis and fever in dairy cows. Theriogenology. 2018;114:25–33. doi: 10.1016/j.theriogenology.2018.03.016. [DOI] [PubMed] [Google Scholar]
  6. da Mata Martins T, da Paixão TA, Costa ÉA, de Carvalho Pires A, Santos RL, Borges ÁM. Postpartum toll-like receptors and β-defensin 5 mRNA levels in the endometrium of Holstein cows. Vet. Immunol. Immunopathol. 2011;139:277–281. doi: 10.1016/j.vetimm.2010.09.012. [DOI] [PubMed] [Google Scholar]
  7. Davies D, Meade KG, Herath S, Eckersall PD, Gonzalez D, White JO, Conlan RS, O’Farrelly C, Sheldon IM. Toll-like receptor and antimicrobial peptide expression in the bovine endometrium. Reprod. Biol. Endocrinol. 2008;6:53. doi: 10.1186/1477-7827-6-53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Eckel EF, Ametaj BN. Role of bacterial endotoxins in the etiopathogenesis of periparturient diseases of transition dairy cows. J. Dairy Sci. 2016;99:5967–5990. doi: 10.3168/jds.2015-10727. [DOI] [PubMed] [Google Scholar]
  9. Fischer C, Drillich M, Odau S, Heuwieser W, Einspanier R, Gabler C. Selected pro-inflammatory factor transcripts in bovine endometrial epithelial cells are regulated during the oestrous cycle and elevated in case of subclinical or clinical endometritis. Reprod. Fertil. Dev. 2010;22:818–829. doi: 10.1071/RD09120. [DOI] [PubMed] [Google Scholar]
  10. Fu Y, Liu B, Feng X, Liu Z, Liang D, Li F, Li D, Cao Y, Feng S, Zhang X. Lipopolysaccharide increases toll-like receptor 4 and downstream toll-like receptor signaling molecules expression in bovine endometrial epithelial cells. Vet. Immunol. Immunopathol. 2013;151:20–27. doi: 10.1016/j.vetimm.2012.09.039. [DOI] [PubMed] [Google Scholar]
  11. Herath S, Dobson H, Bryant C, Sheldon I. Use of the cow as a large animal model of uterine infection and immunity. J. Reprod. Immunol. 2006a;69:13–22. doi: 10.1016/j.jri.2005.09.007. [DOI] [PubMed] [Google Scholar]
  12. Herath S, Fischer DP, Werling D, Williams EJ, Lilly ST, Dobson H, Bryant CE, Sheldon IM. Expression and function of toll-like receptor 4 in the endometrial cells of the uterus. Endocrinology. 2006b;147:562–570. doi: 10.1210/en.2005-1113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Herath S, Lilly ST, Santos NR, Gilbert RO, Goetze L, Bryant CE, White JO, Cronin J, Sheldon IM. Expression of genes associated with immunity in the endometrium of cattle with disparate postpartum uterine disease and fertility. Reprod. Biol. Endocrinol. 2009;7:55–88. doi: 10.1186/1477-7827-7-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kawai T, Akira S. The rule of pattern recognition receptors in innate immunity: update on toll-like receptors. Nat. Immunol. 2010;11:327–384. doi: 10.1038/ni.1863. [DOI] [PubMed] [Google Scholar]
  15. Kim IH, Na KJ, Yang MP. Immune responses during the peripartum period in dairy cows with postpartum endometritis. J. Reprod. Develop. 2005;6:757–764. doi: 10.1262/jrd.17036. [DOI] [PubMed] [Google Scholar]
  16. Koneman EW, Minckler TM, Shires DB, De Jonch DS. Postmortem bacteriology: II Selection of cases for culture. Am. J. Clin. Pathol. 1971;55:17–23. doi: 10.1093/ajcp/55.1.17. [DOI] [PubMed] [Google Scholar]
  17. Lange J, McCarthy A, Kay J, Meier S, Walker C, Crookenden MA, Mitchell MD Loor JJ, Roche JR, Heiser A. Prepartum feeding level and body condition score affect immunological performance in grazing dairy cows during the transition period. J. Dairy Sci. 2016;99:2329–2338. doi: 10.3168/jds.2015-10135. [DOI] [PubMed] [Google Scholar]
  18. Mahnani A, Sadeghi-Sefidmazgi A, Cabrera VE. Consequences and economics of metritis in Iranian Holstein dairy farms. J. Dairy Sci. 2015;98:6048–6057. doi: 10.3168/jds.2014-8862. [DOI] [PubMed] [Google Scholar]
  19. Miyake K. Invited review: roles for accessory molecules in microbial recognition by toll-like receptors. J. Endotoxin Res. 2006;12:195–204. doi: 10.1179/096805106X118807. [DOI] [PubMed] [Google Scholar]
  20. O’Neill LA, Bryant CE, Doyle SL. Therapeutic targeting of toll-like receptors for infectious and inflammatory diseases and cancer. Pharmacol. Rev. 2009;61:1073–1094. doi: 10.1124/pr.109.001073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Reppert EJ. Evidence for the use of ceftiofur for treatment of metritis in dairy cattle. Vet. Clin. Anim. Pract. 2015;31:139–149. doi: 10.1016/j.cvfa.2014.11.007. [DOI] [PubMed] [Google Scholar]
  22. Schöniger S, Gräfe H, Schoon HA. Expression of toll-like receptors 2, 4 and 6 in different cell populations of the equine endometrium. Vet. Immunol. Immunopathol. 2017;185:7–13. doi: 10.1016/j.vetimm.2017.01.002. [DOI] [PubMed] [Google Scholar]
  23. Sheldon IM, Dobson H. Postpartum uterine health in cattle. Anim. Reprod. Sci. 2004;82:295–306. doi: 10.1016/j.anireprosci.2004.04.006. [DOI] [PubMed] [Google Scholar]
  24. Sheldon IM, Lewis GS, LeBlanc S, Gilbert RO. Defining postpartum uterine disease in cattle. Theriogenology. 2006;65:1516–1530. doi: 10.1016/j.theriogenology.2005.08.021. [DOI] [PubMed] [Google Scholar]
  25. Sheldon IM, Noakes D, Rycroft A, Pfeiffer D, Dobson H. Influence of uterine bacterial contamination after parturition on ovarian dominant follicle selection and follicle growth and function in cattle. Reproduction. 2002;123:837–845. [PubMed] [Google Scholar]
  26. Sheldon IM, Rycroft AN, Dogan B, Craven M, Bromfield JJ, Chandler A, Roberts MH, Price SB, Gilbert RO, Simpson KW. Specific strains of Escherichia coli are pathogenic for the endometrium of cattle and cause pelvic inflammatory disease in cattle and mice. Plos One. 2010;5 doi: 10.1371/journal.pone.0009192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Swangchan-Uthai T, Lavender CR, Cheng Z, Fouladi-Nashta AA, Wathes DC. Time course of defense mechanisms in bovine endometrium in response to lipopolysaccharide. Biol. Reprod. 2012;87:113–135. doi: 10.1095/biolreprod.112.102376. [DOI] [PubMed] [Google Scholar]
  28. Takeuchi O, Akira S. Pattern recognition receptors and inflammation. Cell. 2010;140:805–820. doi: 10.1016/j.cell.2010.01.022. [DOI] [PubMed] [Google Scholar]
  29. Takeuchi O, Hoshino K, Akira S. Cutting edge: TLR2-deficient and MyD88-deficient mice are highly susceptible to Staphylococcus aureus infection. J. Immunol. 2000;165:5392–5396. doi: 10.4049/jimmunol.165.10.5392. [DOI] [PubMed] [Google Scholar]
  30. Triantafilou M, Triantafilou K. Lipopoly-saccharide recognition: CD14, TLRs and the LPS-activation cluster. Trends Immunol. 2002;23:301–304. doi: 10.1016/s1471-4906(02)02233-0. [DOI] [PubMed] [Google Scholar]
  31. van der Molen RG, Schutten JHF, van Cranenbroek B, ter Meer M, Donckers J, Scholten RR, van der Heijden OWH, Spaanderman MEA, Joosten I. Menstrual blood closely resembles the uterine immune micro-environment and is clearly distinct from peripheral blood. Hum. Reprod. 2014;29:303–314. doi: 10.1093/humrep/det398. [DOI] [PubMed] [Google Scholar]
  32. Williams EJ, Fischer DP, Pfeiffer DU, England GC, Noakes DE, Dobson H, Sheldon IM. Clinical evaluation of postpartum vaginal mucus reflects uterine bacterial infection and the immune response in cattle. Theriogenology. 2005;63:102–117. doi: 10.1016/j.theriogenology.2004.03.017. [DOI] [PubMed] [Google Scholar]
  33. Yapan S, Liping S, Aizhen G, Liguo Y. Effects of toll-like receptor 2 gene mutation on resistance to bovine brucellosis. Livest. Sci. 2014;170:30–34. [Google Scholar]
  34. Yoshimura A, Lien E, Ingalls R, Heine H, Henneke P, Teti G, Espevik T, Kato I, Golenbock D. Recognition of gram-positive bacterial cell wall components by the innate immune system occurs via toll-like receptor 2. J. Endotoxin Res. 2000;6:S13–S13. [Google Scholar]
  35. Zähringer U, Lindner B, Inamura S, Heine H, Alexander C. TLR2-promiscuous or specific? A critical re-evaluation of a receptor expressing apparent broad specificity. Immunobiology. 2008;213:205–224. doi: 10.1016/j.imbio.2008.02.005. [DOI] [PubMed] [Google Scholar]

Articles from Iranian Journal of Veterinary Research are provided here courtesy of Shiraz University

RESOURCES