KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rat anti-C-peptide | Developmental Studies Hybridoma Bank at the University of Iowa | GN-ID4; RRID:AB_2255626 |
| Mouse anti-NKX6.1 | Developmental Studies Hybridoma Bank at the University of Iowa | F55A12; RRID:AB_532379 |
| Rabbit anti-Beta Tubulin | Cell Signaling Technology | 2128; RRID:AB_823664 |
| Mouse anti-PGK1/2 | Santa Cruz Biotechnology | SC-48342; RRID:AB_628116 |
| Rabbit anti-GAPDH | Cell Signaling Technology | 5174; RRID:AB_10622025 |
| Rabbit anti-PC | Sigma Aldrich | HPA043922; RRID:AB_2678732 |
| Rabbit anti-PCK2 | Cell Signaling Technology | 8565; RRID:AB_11217628 |
| Biological Samples | ||
| Human Cadaveric Islets | See Table S1 | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Phenylacetate | Sigma Aldrich | P16621 |
| Tris-HCl pH 8.5 | VWR | 100219-630 |
| Disposable spinner flasks | Corning | CLS3578 |
| mTeSR basal medium | StemCell Technologies, Inc. | 85850 |
| MCDB131 Basal Medium | Sigma Aldrich | M8537 |
| Fetal Bovine Serum | Life Technologies | 16000044 |
| Fluo-4 | Life Technologies | F14217 |
| Oligomycin A | Fisher Scientific | 49545510MG |
| Disuccinyl Suberate | Life Technologies | 4449754 |
| U-13C Glucose | Cambridge Isotope Laboratories | CLM-1396-0.25 |
| L-Glutamine | Sigma Aldrich | G3126 |
| TSQ | Fisher Scientific | 50850395 |
| Propidium Iodide | Sigma Aldrich | P4864 |
| Sodium Fluoride | Sigma Aldrich | 919 |
| 96 well V-bottom plates | Fisher Scientific | 12565460 |
| methyl Succinate | Sigma Aldrich | P4241-50EA |
| Methyl-pyruvate | VWR | AAA13966 |
| Glyceraldehyde | Sigma Aldrich | 49800 |
| Glyceric Acid | Santa Cruz Biotechnology | SC-234508 |
| Dihydroxyacetone | Santa Cruz Biotechnology | SC499029 |
| B-hydroxybutyrate | Sigma Aldrich | 166898 |
| Ketoisocaproate | VWR | AAH60076-03 |
| D-3-Phosphoglyceric Acid | Santa Cruz Biotechnology | SC-214793B |
| D-2-Phosphoglyceric Acid | Sigma Aldrich | 79470 |
| Tolbutamide | Sigma Aldrich | T0891 |
| Diazoxide | Sigma Aldrich | D9035 |
| Forskolin | Fisher Scientific | NC9084630 |
| MitoTracker Green FM | Life Technologies | M7514 |
| RIPA Lysis Buffer | Fisher Scientific | P189901 |
| Glucose | Sigma Aldrich | G7021 |
| Potassium Chloride | Sigma Aldrich | P9541 |
| Sodium Chloride | Sigma Aldrich | S3014 |
| Calcium Chloride | Sigma Aldrich | C7902 |
| Magnesium Sulfate | Sigma Aldrich | M7506 |
| Sodium Phosphate, Dibasic | Sigma Aldrich | S3264 |
| Potassium Phosphate, Monobasic | Sigma Aldrich | P9791 |
| Sodium Bicarbonate | Sigma Aldrich | S5761 |
| HEPES Buffer | Life Technologies | 15630080 |
| Dynabeads Protein G | Life Technologies | 10003D |
| Bovine Serume Albumin, Fatty acid-free, Fraction V | EMD Millipore | 126575 |
| 2-NBDG | Life Technologies | N13195 |
| Critical Commercial Assays | ||
| Seahorse 24 Xf Mito Fuel Stress Test | Agilent | 103015-100 |
| Seahorse 24 well islet capture plate | Agilent | 101122-100 |
| PGK1 Activity Assay | Biovision | K194 |
| GAPDH enzyme activity assay | Abcam | ab204732 |
| PEP colorimetric Assay | Sigma Aldrich | MAK102-1KT |
| Alpco Human Insulin ELISA | APCO Diagnostics | 80-INSHUU-E10.1 |
| Experimental Models: Cell Lines | ||
| HUES8 hES | Derived In-house | N/A |
| 1016 iPS | Columbia University | N/A |
| Oligonucleotides | ||
| B2M Forward: GCTGGGTAGCTCTAAACAATGTATTCA | This Paper adapted from Phillips et al., 2014 | N/A |
| B2M Reverse: CCATGTACTAACAAATGTCTAAAATGGT | This Paper adapted from Phillips et al., 2014 | N/A |
| B2M FAM Probe: CAGCAGCCTATTCTGC | This Paper adapted from Phillips et al., 2014 | N/A |
| mtMajArc Forward: CTGTTCCCCAACCTTTTCCT | This Paper adapted from Phillips et al., 2014 | N/A |
| mtMajArc Reverse: CCATGATTGTGAGGGGTAGG | This Paper adapted from Phillips et al., 2014 | N/A |
| mtMajArc FAM Probe: GACCCCCTAACAACCCCC | This Paper adapted from Phillips et al., 2014 | N/A |
| mtMinArc Forward: CTAAATAGCCCACACGTTCCC | This Paper adapted from Phillips et al., 2014 | N/A |
| mtMinArc Reverse: AGAGCTCCCGTGAGTGGTTA | This Paper adapted from Phillips et al., 2014 | N/A |
| mtMinArc FAM Probe: CATCACGATGGATCACAGGT | This Paper adapted from Phillips et al., 2014 | N/A |
| Recombinant DNA | ||
| Empty Myc-DDK Lentivirus Plasmid | Origene | PS100064;http://www.origene.com/catalog/vectors/lentiviral-gene-expression-vectors/ps100064/plenti-c-myc-ddk-lentiviral-gene-expression-vector |
| GAPDH Myc-DDK Lentivirus Plasmid | Origene | RC202309L1; https://www.origene.com/cDNA_clone/LentiORF/NM_002046/RC202309L1V/GAPDH.aspx |
| PGK1 Myc-DDK Lentivirus Plasmid | Origene | RC211172L1 |
| Software and Algorithms | ||
| Prism | Graphpad | N/A |
| Wave | Agilent | N/A |
| Zen | Zeiss | N/A |
| ImageJ | National Institutes of Health | https://imagej.nih.gov/ij/ |
| Flowjo | Becton, Dickinson and Company | N/A |
| Other | ||
| AxioZoom 16 | N/A | |
| BioRep Dynamic Perifusion System | N/A | |
| Seahorse XFe 24 well Analyzer | N/A | |