Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Quantitative PCR (qPCR) primer sets used in this study.
| Target gene | Primer name and sequence (5'-3') | Target size (bp) | Reference | |
|---|---|---|---|---|
| Forward | Reverse | |||
| 1h-[NiFe]-hydrogenase large subunit gene (hhyL) | NiFe-244f; GGGATCTGCGGGGACAACCA | NiFe-568r; TCTCCCGGGTGTAGCGGCTC | 324 | (Constant et al., 2010) |
| RuBisCO type IE (rbcL1E) | rbcL1Ef; GGACBGTSGTVTGGACSGA | rbcL1Er; TTGAABCCRAAVACRTTGC | 187 | (Ji et al., 2017) |
| 16S rRNA gene | Eub1048f; GTGSTGCAYGGYTGTCGTCA | Eub1194r; ACGTCRTCCMCACCTTCCTC | 146 | (Maeda et al., 2003) |
