Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo-sapiens) | RH4 (fusion-positive rhabdomyosarcoma) | Other | RRID:CVCL_5916 | See Materials and methods |
| Cell line (Homo-sapiens) | RH5 (fusion-positive rhabdomyosarcoma) | Other | RRID:CVCL_5917 | See Materials and methods |
| Cell line (Homo-sapiens) | SCMC (fusion-positive rhabdomyosarcoma) | Other | See Materials and methods | |
| Recombinant DNA reagent | lentiCRISPRv2 puro (plasmid) | Addgene | #98290; RRID:Addgene_98290 | Cas9 lentiviral expression construct |
| Recombinant DNA reagent | pU6-gRNA-EF1a-RFP657/BFP/EGFP (plasmid) | Other | See Materials and methods | |
| Recombinant DNA reagent | pRSIT-U6Tet-shRNA-PGKTetRep-2A-GFP-2A-puro (plasmid) | Cellecta Inc | Custom made | shRNA lentiviral expression construct, |
| Recombinant DNA reagent | PX459; pSpCas9(BB)−2A-Puro (plasmid) | Addgene | #62988; RRID:Addgene_ 62988 | Cas9 and sgRNA expression construct |
| Antibody | Recombinant Anti-Brd4 (rabbit monoclonal) | Abcam | #ab128874; RRID:AB_11145462 | WB (1:1000) |
| Antibody | BRD4 (rabbit polyclonal) | Bethyl Laboratories | #A301-985A100; RRID:AB_2620184 | ChIP (10 µg) |
| Antibody | Cas9 (mouse monoclonal) | Cell Signaling Technologies | CST:7A9-3A3; #14697; RRID:AB_2750916 | WB (1:1000) |
| Antibody | CHD4 (rabbit polyclonal) | Bethyl Laboratories | #A301-082A; RRID:AB_873002 | WB (1:1000) |
| Antibody | CHD4 (rabbit polyclonal) | Invitrogen | #PA5-27472; RRID:AB_2544948 | ChIP (10 µg) |
| Antibody | Anti-Flag (mouse monoclonal) | Sigma Aldrich | Sigma:M2; #F1804; RRID:AB_262044 | WB (1:1000), ChIP (10 µg), IF (1:250), IP (8 µg) |
| Antibody | FKHR/FOXO1 (rabbit polyclonal) | Santa Cruz Biotechnology | St.Cruz:H-128; #sc-11350; RRID:AB_640607 | WB (1:1000) |
| Antibody | GAPDH (rabbit monoclonal) | Cell Signaling Technologies | CST:14C10; #2118L;RRID:AB_561053 | WB (1:1000) |
| Antibody | HDAC1 (mouse monoclonal) | Cell Signaling Technologies | CST:10E2; #5356; RRID:AB_10612242 | WB (1:1000) |
| Antibody | HDAC2 (mouse monoclonal) | Cell Signaling Technologies | CST:3F3; #5113S; RRID:AB_10624871 | WB (1:1000) |
| Antibody | HDAC2 (rabbit polyclonal) | Abcam | #Ab7029; RRID:AB_305706 | ChIP (14.6 µg) |
| Antibody | Histone H3K9ac (rat monoclonal) | Active Motif | #61663; RRID:AB_2793725 | ChIP (10 µg) |
| Antibody | Histone H3K9me1 (rabbit polyclonal) | Active Motif | #39887; RRID:AB_2793381 | ChIP (10 µg) |
| Antibody | Histone H3K9me3 (rabbit polyclonal) | Active Motif | #39765; RRID:AB_2793334 | ChIP (10 µg) |
| Antibody | Histone H3K27ac (rabbit polyclonal) | Active Motif | #39133; RRID:AB_2561016 | ChIP (7 µg) |
| Antibody | Anti-MTA2 (mouse monoclonal) | Sigma Aldrich | #M7569; RRID:AB_477237 | WB (1:1000) |
| Antibody | MTA2/PID (rabbit polyclonal) | Abcam | #ab8106; RRID:AB_306276 | ChIP (5 µg) |
| Antibody | PAX3-FOXO1 breakpoint specific (mouse monoclonal) | doi:10.1158/0008–5472.CAN-10–0582 | ChIP (10 µg) | |
| Antibody | RBBP4 (rabbit polyclonal) | Bethyl Laboratories | #A301-206A; RRID:AB_890631 | WB (1:1000) |
| Antibody | RBBP4 (rabbit polyclonal) | EpiGentek | #A-2703–050 | ChIP (10 µg) |
| Antibody | RNA Pol II (rat monoclonal) | Active Motif | #61667; RRID:AB_2687513 | ChIP (15 µg) |
| Antibody | Alexa Fluor 594 anti-mouse (goat polyclonal) | Thermo Fisher Scientific | #A11032; RRID:AB_2534091 | IF (1:200) |
| Antibody | Spike-in Antibody (rabbit, clonality not specified) | Active Motif | #61686 | ChIP (2 µl) |
| Sequence-based reagent | Guide RNAs used in CRISPR/Cas9 screen | Microsynth | sgRNAs | See Supplementary file 1 |
| Sequence-based reagent | sg_NCHD4 | Microsynth | sgRNA | 5’GAGCGGAAGG
GGATGGCGTC 3’ |
| Sequence-based reagent | sg_CCHD4 | Microsynth | sgRNA | 5’TCTGCATCTTCACTGCTGCT 3’ |
| Sequence-based reagent | sg_NBRD4 | Microsynth | sgRNA | 5’ATGTCTGCGGAGAGCGGCCCTGG 3’ |
| Sequence-based reagent | Donor DNA | IDT | cDNA | See Supplementary file 1 |
| Sequence-based reagent | Primers for ChIP-qPCR | Microsynth | See Materials and methods | |
| Peptide, recombinant protein | 3xFlag peptide | Sigma-Aldrich | #F4799 | IP elution (200 µg/ml) |
| Commercial assay or kit | Cell Proliferation ELISA, BrdU kit | Roche | #11647229001 | |
| Commercial assay or kit | Pierce BCA Protein Assay Kit | Thermo Fisher Scientific | #23227 | |
| Commercial assay or kit | RNeasy mini Kit | Qiagen | #74106 | |
| Commercial assay or kit | ChIP-IT High Sensitivity kit | Active Motif | #53040 | |
| Commercial assay or kit | iDeal ChIP-seq kit for Transcription Factors | Diagenode | #C01010055 | |
| Commercial assay or kit | TruSeq ChIP Library Preparation Kit | Illumina | #IP-202–1012 | |
| Commercial assay or kit | NextSeq500 High Output Kit v2 | Illumina | #FC-404–2005 | |
| Commercial assay or kit | TruSeq Stranded Total RNA Sample Preparation Kit | Illumina | #20020596 | |
| Chemical compound, drug | DNase I recombinant, RNase-free | Roche | #04716728001 | |
| Chemical compound, drug | 7-amino-actinomycinD | Invitrogen | #A1310 | |
| Chemical compound, drug | Cell Proliferation Reagent WST-1 | Roche | #5015944001 | |
| Chemical compound, drug | Crystal Violet | Sigma-Aldrich | #V5265 | |
| Chemical compound, drug | ChIP Cross-link Gold | Diagenode | #C01019027 | |
| Software, algorithm | ProteoWizard (version 3.0.7494) | http://proteowizard.sourceforge.net/projects.html | RRID:SCR_012056 | |
| Software, algorithm | Trans-Proteomic Pipeline | doi:10.1002/pmic.200900375 | ||
| Software, algorithm | CRAPome 2.0 | doi:10.1038/nmeth.2557 | ||
| Software, algorithm | SAINTexpress | doi:10.1016/j.jprot.2013.10.023 | RRID:SCR_018562 | |
| Software, algorithm | BioGRID 3.5 | doi:10.1093/nar/gky1079 | RRID:SCR_007393 | |
| Software, algorithm | BWA | doi:10.1186/gb-2009-10-3-r25 | RRID:SCR_005476 | |
| Software, algorithm | igvtools | doi:10.1038/nbt.1754 | ||
| Software, algorithm | MACS2 | doi:10.1186/gb-2008-9-9-r137 | RRID:SCR_013291 | |
| Software, algorithm | BEDTools | doi:10.1093/bioinformatics/btq033 | RRID:SCR_006646 | |
| Software, algorithm | HOMER | doi:10.1016/j.molcel.2010.05.004 | RRID:SCR_010881 | |
| Software, algorithm | NGSplot | doi:10.1186/1471-2164-15-284 | RRID:SCR_011795 | |
| Software, algorithm | FastQC v0.11.7 | http://www.bioinformatics.babraham.ac.uk/projects/fastqc | RRID:SCR_014583 | |
| Software, algorithm | Hisat2 v2.1.0 | doi:10.1038/nmeth.3317 | RRID:SCR_015530 | |
| Software, algorithm | Samtools v1.7 | doi:10.1093/bioinformatics/btp352 | RRID:SCR_002105 | |
| Software, algorithm | QualiMap | doi:10.1093/bioinformatics/bts503 | RRID:SCR_001209 | |
| Software, algorithm | featureCounts v1.6.0 | doi:10.1093/bioinformatics/btt656 | RRID:SCR_012919 | |
| Software, algorithm | DESeq2 v3.7 | doi:10.1186/s13059-014-0550-8 | RRID:SCR_015687 | |
| Software, algorithm | GSEA 3.0 | doi:10.1073/pnas.050658010 | RRID:SCR_003199 | |
| Other | Spike-in Chromatin | Active Motif | #53083 |