| Antibodies |
| Rabbit polyclonal anti-ECT2 |
This study |
OD324 |
| Mouse monoclonal anti-Actin |
Milipore |
MAB1501 |
| Goat anti GFP |
Hyman Lab |
OD194 |
| Mouse monoclonal anti alpha-tubulin (clone DM1A) |
Sigma-Aldrich |
Cat #T9026; RRID AB_477593 |
| Goat anti rabbit IgG, HRP-conjugated |
Jackson Immunoresearch |
Cat #111-035-003; RRID AB_2313567 |
| Donkey anti mouse IgG, HRP-conjugated |
Jackson Immunoresearch |
Cat #715-035-150; RRID AB_2340770 |
| Bacterial and Virus Strains |
| Retrovirus: CMV promoter-AcGFP-FLAG |
This study |
N/A |
| Retrovirus: CMV promoter-AcGFP-FLAG-ECT2-WT |
This study |
N/A |
| Retrovirus: CMV promoter-AcGFP-FLAG-ECT2-TK |
This study |
N/A |
| Retrovirus: CMV promoter-AcGFP-FLAG-ECT2-3A |
This study |
N/A |
| Retrovirus: CMV promoter-AcGFP-FLAG-ECT2-3E |
This study |
N/A |
| Chemicals, Peptides, and Recombinant Proteins |
| GST-(PreScission site)-CYK-4 aa 146–190 |
This study |
pOD3454 (Plasmid) |
| GST-(PreScission site)-CYK-4 aa 146–190 4A (T163A/S170A/T177A/S180A) |
This study |
pOD3460 (Plasmid) |
| GST-6His-(PreScission site)-ECT-2 aa 1–320 |
This study |
pOD3411 (Plasmid) |
| GST-6His-(PreScission site)-ECT-2 aa 1–320 3A (R148A/K149A/R154A) |
This study |
pOD3455 (Plasmid) |
| GST-6His-(PreScission site)-ECT-2 aa 1–320 3E (R148E/K149E/R154E) |
This study |
pOD3456 (Plasmid) |
| GST-6His-(PreScission site)-ECT-2 aa 1–320 K166M |
This study |
pOD3422 (Plasmid) |
| GST-(PreScission site)-hCYK4 aa 1–288 |
This study |
pOD3483 (Plasmid) |
| GST-6His-(PreScission site)-hECT2 aa 22–326 |
This study |
pOD3468 (Plasmid) |
| GST-6His-(PreScission site)-hECT2 aa 22–326 3A (R176A/K177A/K182A) |
This study |
pOD3471 (Plasmid) |
| GST-6His-(PreScission site)-hECT2 aa 22–326 3E (R176E/K177E/K182E) |
This study |
pOD3472 (Plasmid) |
| GST-6His-(PreScission site)-hECT2 aa 22–326 TK (T153A/K195M) |
This study |
pOD3475 (Plasmid) |
| Experimental Models: Cell Lines |
| Parental Cell Line: RCL028: HeLa Kyoto |
Gerlich Lab |
RCL028 |
| Engineered Clonal Cell Line: ODCL0123: Modification to Parent Line HeLa Kyoto: CMVpro - AcGFP FLAG |
This study |
ODCL0123 |
| Engineered Clonal Cell Line: ODCL0124: Modification to Parent Line HeLa Kyoto: CMVpro - AcGFP FLAG hECT2 WT |
This study |
ODCL0124 |
| Engineered Clonal Cell Line: ODCL0125: Modification to Parent Line HeLa Kyoto: CMVpro - AcGFP FLAG hECT2 TK mutant (T153A & K195M) |
This study |
ODCL0125 |
| Engineered Clonal Cell Line: ODCL0126: Modification to Parent Line HeLa Kyoto: CMVpro - AcGFP FLAG hECT2 3A-1 (R176A, K177A, K182A) |
This study |
ODCL0126 |
| Engineered Clonal Cell Line: ODCL0127: Modification to Parent Line HeLa Kyoto: CMVpro - AcGFP FLAG hECT2 3A-2 (R176A, K177A, K182A) |
This study |
ODCL0127 |
| Engineered Clonal Cell Line: ODCL0128: Modification to Parent Line HeLa Kyoto: CMVpro - AcGFP FLAG hECT2 3E-1 (R176E, K177E, K182E) |
This study |
ODCL0128 |
| Engineered Clonal Cell Line: ODCL0129: Modification to Parent Line HeLa Kyoto: CMVpro - AcGFP FLAG hECT2 3E-2 (R176E, K177E, K182E) |
This study |
ODCL0129 |
| Experimental Models: Organisms/Strains |
|
C. elegans: Strain wild type N2 (ancestral) |
Caenorhabditis Genetics Center |
N2 |
|
C. elegans: Strain OD1970: ltSi835[pKL62; Pcyk-4::CYK-4reencoded; cb-unc-119(+)]II; unc-119(ed3)III |
[42] |
OD1970 |
|
C. elegans: Strain OD1984: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; unc-119(ed3)III |
This study |
OD1984 |
|
C. elegans: Strain OD2873: ltSi1013[pSG015; Pect-2::ect-2 RE-encoded-exon8::ect-2 3’-UTR; cb unc-119(+)]II;unc-119(ed3)III |
This study |
OD2873 |
|
C. elegans: Strain OD2899: ltSi1014[pSG016; Pzen-4::zen-4 RE-encoded-exon6::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD2899 |
|
C. elegans: Strain OD3009: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1013[pSG015; Pect-2::ect-2 RE-encoded-exon8::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3009 |
|
C. elegans: Strain OD3010: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1014[pSG016; Pzen-4::zen-4 RE-encoded-exon6::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3010 |
|
C. elegans: Strain OD3064: ltSi1239[pSG033; Pect-2::ect-2 RE-encoded-exon8 S4A S64A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3064 |
|
C. elegans: Strain OD3159: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1014[pSG016; Pzen-4::zen-4 RE-encoded-exon6::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3159 |
|
C. elegans: Strain OD3222: ltSi1246[pSG042; Pect-2::ect-2 RE-encoded-exon8 S380A, S478A, S791A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3222 |
|
C. elegans: Strain OD3223: ltSi1247[pSG043; Pect-2::ect-2 RE-encoded-exon8 S171A, S236A, S315A, S362A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3223 |
|
C. elegans: Strain OD3224: ltSi1248[pSG044; Pect-2::ect-2 RE-encoded-exon8 S405A S491A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3224 |
|
C. elegans: Strain OD3225: ltSi1249[pSG045; Pect-2::ect-2 RE-encoded-exon8 S787A S836A S866A S869A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3225 |
|
C. elegans: Strain OD3226: ltSi1250[pSG046; Pect-2::ect-2 RE-encoded-exon8 S917A S918A S922A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3226 |
|
C. elegans: Strain OD3328: ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3328 |
|
C. elegans: Strain OD3433: ltSi1251[pSG047; Pzen-4::zen-4 RE-encoded-exon6 S2A, S21A, T25A, T92A, S93A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3433 |
|
C. elegans: Strain OD3434: ltSi1252[pSG048; Pzen-4::zen-4 RE-encoded-exon6 S51A, S93A, S106A, T157A, T189A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3434 |
|
C. elegans: Strain OD3435: ltSi1256[pSG051; Pzen-4::zen-4 RE-encoded-exon6 T189A, S257A, S259A, T278A, S284A, S285A, S289A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3435 |
|
C. elegans: Strain OD3436: ltSi1257[pSG052; Pzen-4::zen-4 RE-encoded-exon6 T310A, S314A, S347A, S351A, S368A, S369A, S370A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3436 |
|
C. elegans: Strain OD3437: ltSi1255[pSG053; Pzen-4::zen-4 RE-encoded-exon6 S415A, S423A, S425A, S455A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3437 |
|
C. elegans: Strain OD3438: ltSi1253[pSG049; Pzen-4::zen-4 RE-encoded-exon6 S494A, S495A, S499A, S500A, T507A, S532A, S556A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3438 |
|
C. elegans: Strain OD3439: ltSi1254[pSG050; Pzen-4::zen-4 RE-encoded-exon6 S499A, S500A, S607A, S609A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3439 |
|
C. elegans: Strain OD3440: ltSi1258[pSG054; Pzen-4::zen-4 RE-encoded-exon6 T652A, S656A, S661A, S723A, S740A, S770A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3440 |
|
C. elegans: Strain OD3441: ltSi1259[pSG055; Pcyk-4::CYK-4reencoded S3A, S4A, S6A, S15A, S57A, S89A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3441 |
|
C. elegans: Strain OD3443: ltSi1261[pSG057; Pcyk-4::CYK-4reencoded S209A, S211A, S224A, S226A, T232A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3443 |
|
C. elegans: Strain OD3444: ltSi1262[pSG058; Pcyk-4::CYK-4reencoded T259A, T268A, S269A, S273A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3444 |
|
C. elegans: Strain OD3445: ltSi1263[pSG059; Pcyk-4::CYK-4reencoded S293A, S298A, S325A, T326A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3445 |
|
C. elegans: Strain OD3446: ltSi1264[pSG060; Pcyk-4::CYK-4reencoded T587A, S589A, S622A, S646A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3446 |
|
C. elegans: Strain OD3447: ltSi1265[pSG061; Pect-2::ect-2 RE-encoded-exon8 S310A, S315A, S318A, S321A, S323A, S325A, S326A, S331A, S362A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3447 |
|
C. elegans: Strain OD3505: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi835[pKL62; Pcyk-4::CYK-4reencoded::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3505 |
|
C. elegans: Strain OD3507: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1256[pSG051; Pzen-4::zen-4 RE-encoded-exon6 T189A, S257A, S259A, T278A, S284A, S285A, S289A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3507 |
|
C. elegans: Strain OD3619: ltSi1124 [pSG092; Pcyk-4::CYK-4reencoded::mNeongreen::cyk-4::cyk-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3619 |
|
C. elegans: Strain OD3626: ltSi1269[pSG085; Pcyk-4::CYK-4reencoded T163A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3626 |
|
C. elegans: Strain OD3627: ltSi1270[pSG086; Pcyk-4::CYK-4reencoded T177A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3627 |
|
C. elegans: Strain OD3628: ltSi1271[pSG087; Pcyk-4::CYK-4reencoded S180A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3628 |
|
C. elegans: Strain OD3665: ltSi1272[pSG084; Pcyk-4::CYK-4reencoded T163A T177A S180A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3665 |
|
C. elegans: Strain OD3677: ltSi1284[pSG041; Pect-2::ect-2 RE-encoded-exon8 S123A, S331A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3677 |
|
C. elegans: Strain OD3679: ltSi1286[pSG063; Pect-2::ect-2 RE-encoded-exon8 K166M::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3679 |
|
C. elegans: Strain OD3685: ltSi1256[pSG051; Pzen-4::zen-4 RE-encoded-exon6 T189A, S257A, S259A, T278A, S284A, S285A, S289A::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3) III; ltIs37 [pAA64; pie-1/mCHERRY::his-58; unc-119 (+)] IV |
This study |
OD3685 |
|
C. elegans: Strain OD3734: ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)III; plk-1((lt106[plk-1 C52V] lt108[plk-1 L115G])III |
This study |
OD3734 |
|
C. elegans: Strain OD3745: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I;ltSi1292[pSG096; Pcyk-4::CYK-4reencoded T163A S170A T177A S180A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3745 |
|
C. elegans: Strain OD3749: ltSi1296[pSG090; Pcyk-4::CYK-4reencoded Δ210-244aa::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3749 |
|
C. elegans: Strain OD3850: ltSi1298[pSG0104; Pcyk-4::CYK-4reencoded Δ163-180aa::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3850 |
|
C. elegans: Strain OD3861: ltSi1472 [pSG104; Pcyk-4::CYK-4reencoded::mNeongreen Δ163-180aa::cyk-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3861 |
|
C. elegans: Strain OD3862: ltSi1473 [pSG097; Pcyk-4::CYK-4reencoded T163A T177A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3862 |
|
C. elegans: Strain OD3863: ltSi1474 [pSG098; Pcyk-4::CYK-4reencoded T177A S180A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3863 |
|
C. elegans: Strain OD3864: ltSi1475 [pSG099; Pcyk-4::CYK-4reencoded T163A S170A T177A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3864 |
|
C. elegans: Strain OD3865: ltSi1476 [pSG100; Pcyk-4::CYK-4reencoded T163A S180A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3865 |
|
C. elegans: Strain OD3866: ltSi1477 [pSG101; Pcyk-4::CYK-4reencoded S170A T177A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3866 |
|
C. elegans: Strain OD3867: ltSi1478 [pSG102; Pcyk-4::CYK-4reencoded T163A S170A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3867 |
|
C. elegans: Strain OD3868: ltSi1479 [pSG103; Pcyk-4::CYK-4reencoded S170A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD3868 |
|
C. elegans: Strain OD3870: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1290[pSG068; Pect-2::ect-2 RE-encoded-exon8 Δ559-729aa (PH domain deIetion)::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3870 |
|
C. elegans: Strain OD3872: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1288[pSG064; Pect-2::ect-2 RE-encoded-exon8 Δ116-190aa (BRCT-1 domain deletion)::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD3872 |
|
C. elegans: Strain OD4077: ltSi1480 [pSG113; Pect-2::mNeonGreen::ect-2 RE-encoded-exon8::ect-2 3’-UTR; cb unc-119(+)]II;unc-119(ed3)III |
This study |
OD4077 |
|
C. elegans: Strain OD4080: ltSi1483 [pSG116; Pect-2::mNeonGreen::ect-2 RE-encoded-exon8:: Δ559-726aa (PH domain deIetion)::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4080 |
|
C. elegans: Strain OD4129: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I;ltSi1298[pSG0104; Pcyk-4::CYK-4reencoded Δ163-180aa::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD4129 |
|
C. elegans: Strain OD4131: ltSi1292[pSG096; Pcyk-4::CYK-4reencoded T163A S170A T177A S180A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD4131 |
|
C. elegans: Strain OD4132: ltSi1485[pSG118; Pect-2::ect-2 RE-encoded-exon8 R148A K149A R154A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4132 |
|
C. elegans: Strain OD4133: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1485[pSG0118; Pect-2::ect-2 RE-encoded-exon8 R148A K149A R154A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4133 |
|
C. elegans: Strain OD4134: ltSi1486[pSG119; Pect-2::ect-2 RE-encoded-exon8 R148E K149E R154E::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4134 |
|
C. elegans: Strain OD4135: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1486[pSG0119; Pect-2::ect-2 RE-encoded-exon8 R148E K149E R154E::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4135 |
|
C. elegans: Strain OD4338: ltSi1491[pSG121; Pzen-4::zen-4 RE-encoded-exon6::Scarlet::zen-4 3’-UTR; cb unc-119(+)]I; ltSi1480 [pSG113; Pect-2::mNeonGreen::ect-2 RE-encoded-exon8::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4338 |
|
C. elegans: Strain OD4382: ltSi1491[pSG121; Pzen-4::zen-4 RE-encoded-exon6::Scarlet::zen-4 3’-UTR; cb unc-119(+)]I; plk-1(lt18[plk-1::sGFP]::loxp) |
This study |
OD4382 |
|
C. elegans: Strain OD4555: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1286[pSG063; Pect-2::ect-2 RE-encoded-exon8 K166M::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4555 |
|
C. elegans: Strain OD4559: ltSi1491[pSG121; Pzen-4::zen-4 RE-encoded-exon6::Scarlet::zen-4 3’-UTR; cb unc-119(+)]I; ltSi1490 [pSG120; Pect-2::mNeonGreen::ect-2 1-320aa::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III; unc-119(ed3)III; ltSi1489[pKL62; Pcyk-4::CYK-4reencoded::cyk-4 3’UTR; cb-unc-119(+)]V |
This study |
OD4559 |
|
C. elegans: Strain OD4560: ltSi1491[pSG121; Pzen-4::zen-4 RE-encoded-exon6::Scarlet::zen-4 3’-UTR; cb unc-119(+)]I; ltSi1490 [pSG120; Pect-2::mNeonGreen::ect-2 1-320aa::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III; unc-119(ed3)III; ltSi1487[pSG096; Pcyk-4::CYK-4reencoded T163A S170A T177A S180A::cyk-4 3’UTR; cb-unc-119(+)]V |
This study |
OD4560 |
|
C. elegans: Strain OD4561: ltSi1491[pSG121; Pzen-4::zen-4 RE-encoded-exon6::Scarlet::zen-4 3’-UTR; cb unc-119(+)]I; ltSi1490 [pSG120; Pect-2::mNeonGreen::ect-2 1-320aa::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4561 |
|
C. elegans: Strain OD4563: ltSi1491[pSG121; Pzen-4::zen-4 RE-encoded-exon6::Scarlet::zen-4 3’-UTR; cb unc-119(+)]I; ltSi1492 [pSG122; Pect-2::mNeonGreen::ect-2 1-320aa R148A K149A R154A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4563 |
|
C. elegans: Strain OD4645: ltSi1491[pSG121; Pzen-4::zen-4 RE-encoded-exon6::Scarlet::zen-4 3’-UTR; cb unc-119(+)]I; ltSi835[pKL62; Pcyk-4::CYK-4reencoded::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD4645 |
|
C. elegans: Strain OD4650: ltSi1491[pSG121; Pzen-4::zen-4 RE-encoded-exon6::Scarlet::zen-4 3’-UTR; cb unc-119(+)]I; ltSi1494 [pSG127; Pect-2::mNeonGreen::ect-2 1-320aa K166M::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4650 |
|
C. elegans: Strain OD4653: ltSi1495[pSG124; Pcyk-4::CYK-4 reencoded S170A S180A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD4653 |
|
C. elegans: Strain OD4654: ltSi1496[pSG125; Pcyk-4::CYK-4 reencoded T163A S170A S180A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD4654 |
|
C. elegans: Strain OD4655: ltSi1497[pSG126; Pcyk-4::CYK-4 reencoded S170A T177A S180A::cyk-4 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III |
This study |
OD4655 |
|
C. elegans: Strain OD4656: ltSi1014[pSG016; Pzen-4::zen-4 RE-encoded-exon6::zen-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3) III; ltIs37 [pAA64; pie-1/mCHERRY::his-58; unc-119 (+)] IV |
This study |
OD4656 |
|
C. elegans: Strain OD4658: ltSi1124 [pSG092; Pcyk-4::CYK-4reencoded T163A S170A T177A S180A::mNeongreen::cyk-4::cyk-4 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III |
This study |
OD4658 |
|
C. elegans: Strain OD4835: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1485[pSG118; Pect-2::ect-2 RE-encoded-exon8 R148A K149A R154A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III; unc-119(ed3)III; ltSi1489[pKL62; Pcyk-4::CYK-4reencoded::cyk-4 3’UTR; cb-unc-119(+)]V |
This study |
OD4835 |
|
C. elegans: Strain OD4836: ltSi849[pKL120; Pmex-5::mCh-PH::tbb-2 3’UTR; cb-unc-119(+)]I; ltSi1485[pSG118; Pect-2::ect-2 RE-encoded-exon8 R148A K149A R154A::ect-2 3’-UTR; cb unc-119(+)]II; unc-119(ed3)III; unc-119(ed3)III; ltSi1487[pSG096; Pcyk-4::CYK-4reencoded T163A S170A T177A S180A::cyk-4 3’UTR; cb-unc-119(+)]V |
This study |
OD4836 |
| Oligonucleotides |
| ON-TARGETplus Non-targeting siRNA #1 |
Dharmacon |
D-001810-01-05 |
| siGENOME Human ECT2 siRNA |
Thermo Scientific |
D-006450-02 |
| Primer pair for synthesis of dsRNA targeting cyk-4 (K08E3.6): (Oligo 1: AATTAACCCTCACTAAAGGGATGT, Oligo 2: TAATACGACTCACTATAGGCTTCGAATTGGCAGCAGC); Template: N2 genomic DNA |
This paper |
N/A |
| Primer pair for synthesis of dsRNA targeting ect-2 (T19E10.1): (Oligo 1: AATTAACCCTCACTAAAGGCAAAGAAGCTCTGGAATGTGAG, Oligo 2: TAATACGACTCACTATAGGCAAAACTTCGTCAATCGCTTTTG); Template: N2 genomic DNA |
This paper |
N/A |
| Primer pair for synthesis of dsRNA targeting zen-4 (M03D4.1): (Oligo 1: AATTAACCCTCACTAAAGGTCAACTCTTCTTACTATGATTCGCC, Oligo 2: TAATACGACTCACTATAGGTGTACGAGACTGAAGAACCG); Template: N2 genomic DNA |
This paper |
N/A |
| Primer pair for synthesis of dsRNA targeting spd-1 (Y34D9A.4): (Oligo 1: TAATACGACTCACTATAGGTCGTTGACGCGTACTCAACT, Oligo 2: AATTAACCCTCACTAAAGGGAATTCGAAATCCGACTCCA); Template: N2 cDNA |
This paper |
N/A |
| Primer pair for synthesis of dsRNA targeting nop-1 (F25B5.2): (Oligo 1: TAATACGACTCACTATAGGCAAACGAAAAAGGAGAAACATTG, Oligo 2: AATTAACCCTCACTAAAGGCTAACATTCCGAAGGTGATCAAG); Template: N2 cDNA |
This paper |
N/A |
| Primer pair for synthesis of dsRNA targeting perm-1 (T01H3.4): (Oligo 1: TAATACGACTCACTATAGGAATTTTCTAGGTCGTCAATCTTCA, Oligo 2: AATTAACCCTCACTAAAGGCGAAAACGCGATCATTTTTA); Template: N2 cDNA |
This paper |
N/A |
| Recombinant DNA |
| Plasmid: pOD3889: CMV promoter-AcGFP-FLAG - pQCXIB |
This study |
pOD3889 |
| Plasmid: pOD3890: CMV promoter-AcGFP-FLAG-ECT2-WT (RNAi-resistant) - pQCXIB |
This study |
pOD3890 |
| Plasmid: pOD3891: CMV promoter-AcGFP-FLAG-ECT2-TK (RNAi-resistant) - pQCXIB |
This study |
pOD3891 |
| Plasmid: pOD3892: CMV promoter-AcGFP-FLAG-ECT2-3A (RNAi-resistant) - pQCXIB |
This study |
pOD3892 |
| Plasmid: pOD3893: CMV promoter-AcGFP-FLAG-ECT2-3E (RNAi-resistant) - pQCXIB |
This study |
pOD3893 |
| Software and Algorithms |
| Fiji |
[46] |
RRID: SCR_002285 |
| Prism |
Graphpad |
RRID: SCR_002798 |
