Table 3.
Excerpt from a literature survey completed in 2015 of the various probes available for detecting Alexandrium species. The complete literature survey is presented as supplemental material in Table S1. The literature citation, rDNA target domain, the original species the probe was designed to target, the probe sequences, and the actual species the probes will detect on the basis of current taxonomy are listed. The reverse primers and in situ hybridization probes target the noncoding strand. The probes are all listed in 5′–3′ orientation. The ribosomal gene locations of the primers and probes listed in this table are also identified in Figs 14 and S7–S9 on the species coding strand in 5′–3′ orientation.
| PCR primers |
Reporter probe/Detects |
Forward probe |
Reverse probe |
||||||
|---|---|---|---|---|---|---|---|---|---|
| Reference | Domain | Target species | Assay type | Forward primer coding (sense) strand | Reverse primer/in situ probe noncoding (antisense) strand | Coding strand | BLAST search results | BLAST search results | |
| 56 | Vandersea et al., this study | LSU D1-D2 | A. fundyense | qPCR SYBR green | GATAAGTCTCCTGT GGGGGG | AAGCACAGGAACACA CACATA | A. fundyense | A. fundyense | |
| LSU D1-D2 | A. pacificum | PCR | CTTGCTTTGTGTGCCAGTTTT | ACCTCAAGGACAAGGACACAA | A. pacificum | A. pacificum | |||
| LSU D1-D2 | A. minutum | PCR | TTGTGCTTACTCTATCATTTATAT | AAATTTCACCAAACACATGCGT | A. minutum | A. minutum | |||
| LSU D1-D2 | A. monilatum | PCR | TGTTTGCATTTATGTGTTGAACA | CACAGGCACCTTACCTTTCAT | A. monolatum | A. monolatum | |||
| LSU D1-D2 | A. monilatum | qPCR TaqMan | TGAAAGGTAAGGTGCCTGTG | GCAGAAACATGTTGCCAAAG | TGCAAGCACAAGCAA CCCAGC A. monilatum | A. monolatum | A. monolatum | ||
| LSU D1-D2 | A. ostenfeldii | qPCR SYBR green | TGAGATTGTTGCGTCCACTTGT | AGGGAGGAGAGCCCTCCC | A. ostenfeldii | A. ostenfeldii | |||
| LSU D1-D2 | A. tamarense | PCR | TGAGATTGTTGCGTCCACTTGT | AGGGAGGAGAGCCCTCCC | A. tamarense | A. tamarense | |||
| 57 | Zhang & Li 2012 | 5.8S | Alexandrium genus | qPCR SYBR green | GATGAAGAATGCAGCAAAATG | CAAACCTTCAAGAATATCC | Alexandrium genus |
A.
fundyense A. pacificum A. tamarense |
|
| 58 | Zhen et al. 2011 | SSU | A. catenella | nuclease protection - sandwich hybridization | ATTTGGCACAGCCTGAGCATTTATC capture probe |
A.
australiense A. pacificum A. tamarense A. fundyense A. tamiyavanichii |
|||
| SSU | CACACCACACAGTCAAGTGCAGTTGTGCTTTCAAGATAAATGCTCAGGCTGTGCCAAAT nuclease protection probe |
A. affine A. cohorticula A. fundyense A. pacificum A. tamarense |
|||||||
| SSU | ACAACTGCACTTGACTGTGTGGTGTG signal probe | A. tamiyavanichii Alexandrium genus | |||||||