KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Bacterial strains | ||
| Escherichia coli BL21 Rosetta™ (DE3) pLysS | Merck | Cat#70954 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Kanamycin sulfate | Sigma-Aldrich | Cat#K1377–25G |
| Chloramphenicol | Fisher Scientific | Cat#BP904–100 |
| Ni-NTA agarose resin | Qiagen | Cat#30210 |
| 1,4-dithiotreitol (DTT) | GoldBio | Cat#DTT25 |
| β-mercaptoethanol | Sigma-Aldrich | Cat#M6250 |
| β-Nicotinamide adenine dinucleotide, reduced disodium salt (NADH) | Sigma-Aldrich | Cat#N7410 |
| Adenosine 5′-triphosphate disodium salt hydrate | Sigma-Aldrich | Cat#A6419 |
| Bovine Serum Albumin, fraction V | Bioworld | Cat#22070008 |
| Dimethylsulfoxide (DMSO) | Sigma-Aldrich | Cat#276855 |
| L-Glutathione reduced | Sigma-Aldrich | Cat#G6529 |
| Imidazole | Sigma-Aldrich | Cat#I2399 |
| Sodium phosphate dibasic anhydrous | Fisher Scientific | Cat#S374500 |
| Sodium phosphate monobasic monohydrate | Fisher Scientific | Cat#S369500 |
| PIPES | Sigma-Aldrich | Cat#P6757 |
| MES hydrate | Sigma-Aldrich | Cat#M8250 |
| Tris base | Fisher Scientific | Cat#BP152–1 |
| Potassium chloride | Fisher Scientific | Cat#P2173 |
| Sodium chloride | Fisher Scientific | Cat#S2173 |
| Potassium hydroxide | Fisher Scientific | Cat#P250500 |
| Sodium hydroxide | Fisher Scientific | Cat#S374500 |
| Magnesium chloride hexahydrate | Fisher Scientific | Cat#M33500 |
| EGTA | Sigma-Aldrich | Cat#E3889 |
| Sucrose | Sigma-Aldrich | Cat#S0389 |
| Saponin | Sigma-Aldrich | Cat#S4521 |
| Paraformaldehyde | EMS | Cat#15710 |
| Sodium azide | Sigma-Aldrich | Cat#71290 |
| D-Lactic Dehydrogenase (LDH) | Sigma-Aldrich | Cat#L3888 |
| Phenylmethylsulfonyl fluoride (PMSF) | Sigma-Aldrich | Cat#P7626 |
| Phospho(enol)pyruvic acid monopotassium salt (PEP) | Sigma-Aldrich | Cat#P7127 |
| Pyruvate Kinase from rabbit muscle (PK) | Sigma-Aldrich | Cat#P9136 |
| Roche cOmplete, EDTA-free Protease Inhibitor | Sigma-Aldrich | Cat#11873580001 |
| Tris(2-carboxyethyl)phosphine HCl (TCEP) | GoldBio | Cat#TCEP10 |
| Triton™ X-100 | Sigma-Aldrich | Cat#X100–100ML |
| Sodium dodecyl sulfate (SDS) | Sigma-Aldrich | Cat#L4509 |
| Miller’s LB medium | Formedium | Cat#LMM105 |
| Isopropyl-beta-D-thiogalactoside (IPTG) | GoldBio | Cat#I2481 |
| McCoy’s 5A medium | ATCC | Cat#30–2007 |
| IMDM medium | Thermo-Fisher | Cat#12440053 |
| Penicillin/Streptomycin (10000 U/ml) | Thermo-Fisher | Cat#15140122 |
| Fetal Bovine Serum (Heat Inactivated) | Sigma-Aldrich | Cat#F4135 |
| Glutamine (200 mM) | Thermo-Fisher | Cat#25030081 |
| Resazurin sodium salt | Sigma-Aldrich | Cat#R7017 |
| 1x DPBS | Thermo-Fisher | Cat#14190144 |
| CloneAmp HiFi PCR Premix | Clontech | Cat#639298 |
| High-Pure RNA isolation kit | Roche | Cat#11828665001 |
| TruSeq® Stranded Total RNA Library Prep | Illumina | Cat#20020596 |
| SYPRO® Orange | Sigma-Aldrich | Cat#S5692 |
| n-propyl gallate | Sigma-Aldrich | Cat#02370 |
| Hoechst 33342 | Thermo-Fisher | Cat#62249 |
| JF646-Hoechst | Legant et al., 2016 | NA |
| Anti-α-tubulin-FITC antibody, mouse monoclonal (clone DM1A) | Sigma-Aldrich | Cat#F2168 |
| Recombinant DNA | ||
| pcDNA5-FRT-TO-Myc-LAP-Cenp-E | Gift from Grishchuk and Cleveland labs | Kim et al., 2010 |
| pET28_Hs_CENPE (aa1–341) | This work | NA |
| Oligonucleotides (5’ to 3’) | ||
| ATAGTTGATCATCCTACATTCTGAC | This work | primer for Sanger sequencing of CENPE exons 3 and 4 |
| GATAAAAGTGAATCTATGCTATGCC | This work | primer for Sanger sequencing of CENPE exons 3 and 4 |
| TCCTACAGAATTATGGTTCCATTTGC | This work | primer for Sanger sequencing of CENPE exons 6 to 8 |
| CCTCCCACATTTAGTTTAGTTAACAG | This work | primer for Sanger sequencing of CENPE exons 6 to 8 |
| GATGACCTAGCAACTACACAGTCGA | This work | primer for PCR amplification of CENPE/UBE2D3 truncation |
| GTTACATTTGGGGAACAGTGACAGG | This work | primer for PCR amplification of CENPE/UBE2D3 truncation |
| GAAGTTTCCAGGAATTTGCATATGG | This work | primer for Sanger sequencing of CENPE/UBE2D3 truncation |
| CTAGCTATCTTTGTGACTTG | This work | primer for Sanger sequencing of CENPE/UBE2D3 truncation |
| Deposited data | ||
| CENPE motor domain, human | Garcia-Saez et al., 2004 | PDB:1T5C |
| Human genome (GRCh38), version 25 (Ensembl 85) | GENCODE | gencode-help@sanger.ec.uk |
| RNAseq: KBM7 parental cells and GSK923295-resistant KBM7 clones 1, 2, 3 | This work | BioProjectID: PRJNA561192 |
| Experimental Models: Cell Lines | ||
| HCT116 | ATCC | Cat#CCL-247 |
| KBM7 | Wang et al., 2015 | NA |
| Software and Algorithms | ||
| GraphPad Prism version 6.0 | GraphPad Software | https://www.graphpad.com/ |
| MacVector (version 17.0.4) | MacVector, Inc | https://macvector.com |
| STAR aligner | Dobin A et al., 2013 | https://github.com/alexdobin/STAR |
| Picard | Broad Institute | http://broadinstitute.github.io/picard/ |
| DexSeq | Anders et al., 2012 | https://bioconductor.org/packages/release/bioc/html/DEXSeq.html |
| Rstudio | Version 1.2.1335 | https://www.rstudio.com/ |
| featureCounts | Liao et al., 2014 | http://subread.sourceforge.net/ |
| SamTools | Li et al., 2009 | http://www.htslib.org/ |
| VarScan | Koboldt et al., 2013 | https://github.com/dkoboldt/varscan |
| Fiji | Schindelin et al. 2012 | https://imagej.net/Fiji |