Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | FVB/NJ | Jackson Laboratory | 001800 | RRID:IMSR_JAX:001800 |
| Genetic reagent (Mus musculus) | BALB/cJ | Jackson Laboratory | 000651 | RRID:IMSR_JAX:000651 |
| Genetic reagent (Mus musculus) | FVB/N-Tg(MMTV-neu)202Mul/J | Jackson Laboratory | 002376 | RRID:IMSR_JAX:002376 |
| Genetic reagent (Mus musculus) | FVB/N-Tg(MMTV-PyVT)634Mul/J | Jackson Laboratory | 002374 | RRID:IMSR_JAX:002374 |
| Genetic reagent (Mus musculus) | FVB/N-Brca1f/fTrp53f/f Tg(Krt14-Cre) | Liu et al., 2007 | Jos Jonkers RRID:MGI:3762188 |
|
| Cell line (Mus musculus) | N148 | This paper | Primary cell line derived from Neu tumor. Description can be found under the‘Limiting dilution transplantation’ section in Materials and methods | |
| Cell line (Mus musculus) | FF99WT | This paper | Primary cell line derived from PyMT tumor. Description can be found under the ‘Animals’ section in Materials and methods | |
| Cell line (Mus musculus) | 4T1 | ATCC | CRL-2539 | RRID:CVCL_0125 |
| Antibody | Anti-CD14 (Rabbit polyclonal) | Invitrogen | PA5-78957 | IHC (1:200) RRID:AB_2746073 |
| Antibody | Anti-ErbB2 (Rabbit monoclonal) | Cell Signaling Technology | 2165 | IHC (1:200) RRID:AB_10692490 |
| Antibody | Anti-Mki67 (Rabbit monoclonal) | Spring Bioscience | M3062 | IHC (1:200) RRID:AB_11219741 |
| Antibody | Anti-Irf1 (Rabbit monoclonal) | Cell Signaling Technology | 8478 | IHC (1:200) RRID:AB_10949108 |
| Antibody | Anti-p-Stat3 (Rabbit monoclonal) | Cell Signaling Technology | 9145 | WB (1:1000) RRID:AB_2491009 |
| Antibody | Anti-Stat3 (Mouse monoclonal) | Cell Signaling Technology | 9139 | WB (1:1000) RRID:AB_331757 |
| Antibody | Anti-beta Actin (Mouse monoclonal) | Sigma | A5441 | WB (1:1000) RRID:AB_476744 |
| Antibody | PE Anti-CD24 (Rat monoclonal) | BD Biosciences | 553262 | Flow (1:200) RRID:AB_394741 |
| Antibody | APC Anti-CD31 (Rat monoclonal) | Biolegend | 102410 | Flow (1:500) RRID:AB_312905 |
| Antibody | APC Anti-TER119 (Rat monoclonal) | Biolegend | 116212 | Flow (1:500) RRID:AB_313713 |
| Antibody | APC Anti-CD45 (Rat monoclonal) | Biolegend | 103112 | Flow (1:500) RRID:AB_312977 |
| Antibody | APC/Cy7 Anti-CD14 (Rat monoclonal) | Biolegend | 123317 | Flow (1:200) RRID:AB_10900813 |
| Sequence-based reagent | CD14 F | IDT | qPCR primer | ACCGACCATGGAGCGTGTG |
| Sequence-based reagent | CD14 R | IDT | qPCR primer | GCCGTACAATTCCACATCTGC |
| Sequence-based reagent | BCL3 F | IDT | qPCR primer | CCGGAGGCCCTTTACTACCA |
| Sequence-based reagent | BCL3 R | IDT | qPCR primer | GGAGTAGGGGTGAGTAGGCAG |
| Sequence-based reagent | OSMR F | IDT | qPCR primer | CATCCCGAAGCGAAGTCTTGG |
| Sequence-based reagent | OSMR R | IDT | qPCR primer | GGCTGGGACAGTCCATTCTAAA |
| Sequence-based reagent | NFKBIA F | IDT | qPCR primer | TGAAGGACGAGGAGTACGAGC |
| Sequence-based reagent | NFKBIA R | IDT | qPCR primer | TTCGTGGATGATTGCCAAGTG |
| Commercial assay or kit | 10x Chromium single-cell kit | 10x Genomics | V2 chemistry | |
| Software, algorithm | Cell Ranger | 10x Genomics | ||
| Software, algorithm | Single-cell RNA sequencing analysis | This paper | https://github.com/ZhuXiaoting/BreastCancer_SingleCell (copy archived at https://github.com/elifesciences-publications/BreastCancer_SingleCell) |