Appendix 1—key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | BL21(DE3) | Novagen | Cat.#: 69450 | competent cells |
| Cell line (Homo-sapiens) |
HeLa Tet-On cells | Takara Bio | Cat.#: 631183 RRID:CVCL_V353 |
Cell based detyrosination assay |
| Transfected construct (Homo-sapiens) |
pCS2-MYC-human VASH1 WT | This paper | Cell based detyrosination assay | |
| Transfected construct (Homo-sapiens) |
pCS2-MYC-human VASH1 R148E | This paper | Cell based detyrosination assay | |
| transfected construct (Homo-sapiens) |
pCS2-MYC-human VASH1 D155R | This paper | Cell based detyrosination assay | |
| Transfected construct (Homo-sapiens) |
pCS2-MYC-human VASH1 K145E/R148E | This paper | Cell based detyrosination assay | |
| Transfected construct (Homo-sapiens) |
pCS2-MYC-human VASH1 H268E/V270E | This paper | Cell based detyrosination assay | |
| Transfected construct (Homo-sapiens) |
pCS2-MYC-human VASH1 R234E/R299E/L303E |
This paper | Cell based detyrosination assay | |
| Transfected construct (Homo-sapiens) |
pCS2-MYC-human SVBP | This paper | Cell based detyrosination assay | |
| Antibody | anti-Myc (Mouse monoclonal) | Roche | Cat.#: 11667203001, RRID:AB_390911 | WB (1:5000) |
| Antibody | anti-α-tubulin (Mouse monoclonal) | Sigma-Aldrich | Cat.#: T6199, RRID:AB_477583 | WB (1:2000) |
| Antibody | anti-detyrosinated tubulin (rabbit Polyclonal) |
EMD Millipore | Cat.#: AB320, RRID:AB_177350 |
WB (1:2000) |
| Antibody | anti-GST (Mouse monoclonal) | Sigma-Aldrich | Cat.#: SAB4200237, RRID:AB_2858197 |
WB (1:2000) |
| Antibody | anti-rabbit IgG (H+L) (Dylight 800 conjugates) |
Cell signaling | Cat.#:5151 RRID:AB_10697505 |
WB (1:5000) |
| Antibody | anti-mouse IgG (H+L) (Dylight 680 conjugates) |
Cell signaling | Cat.#: 5470 RRID:AB_10696895 |
WB (1:5000) |
| Recombinant DNA reagent | pRSF-32M-3C-VASH152–310 WT | This paper | See Materials and methods, Section: Protein expression and purification | |
| Recombinant DNA reagent | pRSF-32M-3C-VASH152–310 C169S | This paper | See Materials and methods, Section: Protein expression and purification | |
| Recombinant DNA reagent | pRSF-32M-3C-VASH152–310K145E/R148E | This paper | See Materials and methods, Section: Protein expression and purification | |
| Recombinant DNA reagent | pRSF-32M-3C-VASH152–310H268E/V270E | This paper | See Materials and methods, Section: Protein expression and purification |
|
| Recombinant DNA reagent | pRSF-32M-3C-VASH152–310R234E/R299E/L303E | This paper | See Materials and methods, Section: Protein expression and purification | |
| Recombinant DNA reagent | pRSF-32M-3C-VASH152–310 D155R | This paper | See Materials and methods, Section: Protein expression and purification | |
| Recombinant DNA reagent | pET-32M-3C-SVBP | This paper | See Materials and methods, Section: Protein expression and purification | |
| Recombinant DNA reagent | pET-21b-SVBP | This paper | See Materials and methods, Section: Protein expression and purification purification | |
| Sequence-based reagent | VASH1_1up Fse1 sense | This paper | PCR primers | GGAGGCCGGCCAATGCCAGGGGGGAAGAAG |
| Sequence-based reagent | VASH1_52 up Fse1 sense | This paper | PCR primers | CGAGGCCGGCCAGACCTGCGAGACGGAGGC |
| Sequence-based reagent | VASH1_310 down Asc1 anti-ense | This paper | PCR primers | CCAGGCGCGCCCTAGACCCGGATCTGGTACCC |
| Sequence-based reagent | VASH1_365 down Asc1 anti-ense | This Paper | PCR primers | CCAGGCGCGCCCTAGACCCGGATCTGGTACCC |
| Sequence-based reagent | SVBP_1up Fse1 sense | This Paper | PCR primers | TGCGGCCGGCCAATGGATCCACCTGCACGT |
| Sequence-based reagent | SVBP_66 down Asc1 anti-sense | This Paper | PCR primers | CGTGGCGCGCCTCATTCTCCAGGAGGCTGC |
| Sequence-based reagent | VASH1_C169S anti-sense | This Paper | PCR primers | TTTGATTGGCAGGGCCTCT |
| Sequence-based reagent | VASH1_C169S sense | This Paper | PCR primers | AGCCTGGAAGCCGTGATCC |
| Sequence-based reagent | VASH1 K145E anti-sense | This Paper | PCR primers | AATTTCAAAGAACTGTGTCCCTGT |
| Sequence-based reagent | VASH1 K145E sense | This Paper | PCR primers | GAGAAGAGCAGACCTCTGACAGG |
| Sequence-based reagent | VASH1 R148E anti-sense | This Paper | PCR primers | GCTCTTCTTAATTTCAAAGAACTGT |
| Sequence-based reagent | VASH1 R148E sense also used for K145E/R148E mutation | This Paper | PCR primers | GAACCTCTGACAGGGCTGATG |
| Sequence-based reagent | VASH1 K145E/R148E anti-sense | This Paper | PCR primers | GCTCTTCTCAATTTCAAAGAACTGT |
| Sequence-based reagent | VASH1_D155R sense | This Paper | PCR primers | AGGGCTGATGCGCCTGGCCAAGG |
| Sequence-based reagent | VASH1_D155R anti-sense | This Paper | PCR primers | GTCAGAGGTCTGCTCTTC |
| Sequence-based reagent | VASH1_R234E sense | This Paper | PCR primers | GCCCGCCTTCGAGACGCTCAGCG |
| Sequence-based reagent | VSH1_R234E anti-sense | This Paper | PCR primers | GGCTTGTACATCAGGTCC |
| Sequence-based reagent | VASH1_268/270E sense | This Paper | PCR primers | CGAGGAGCAGATCGAGTGGAAGCAC |
| Sequence-based reagent | VASH1_268/270E anti-sense | This Paper | PCR primers | CTCTCCGGGTCGTGTGACACGCT |
| Sequence-based reagent | VASH1_R299E sense | This Paper | PCR primers | GCGCCACGCCGAGGACATGCGGC |
| Sequence-based reagent | VASH1_R299E anti-sense | This Paper | PCR primers | TCCAGCTCCTTGCGGAAG |
| Sequence-based reagent | VASH1_L303E sense | This Paper | PCR primers | CGACATGCGGGAGAAGATTGGCAAAGGGACGGGC |
| Sequence-based reagent | VASH1_L303E anti-sense | This Paper | PCR primers | CGGGCGTGGCGCTCCAGC |
| Peptide, recombinant protein | VASH152-310 WT in complex with SVBP | This paper | In vitro detyrosination and pelleting assay | |
| Peptide, recombinant protein | VASH152-310 D155R in complex with SVBP | This paper | In vitro detyrosination | |
| Peptide, recombinant protein | VASH152-310 K145E/R148E in complex with SVBP | This paper | In vitro detyrosination and pelleting assay | |
| Peptide, recombinant protein | VASH152-310 H268E/V270E in complex with SVBP | This paper | In vitro detyrosination and pelleting assay | |
| Peptide, recombinant protein | VASH152-310 R234E/R299E/L303E in complex with SVBP | This paper | In vitro detyrosination and pelleting assay | |
| chemical compound, drug | GMPCPP | Jena Bioscience | Cat.#: NC0641143 | |
| chemical compound, drug | Taxol | Cytoskeleton | Cat.#: TXD01 | |
| chemical compound, drug | Nocodazole | Sigma-Aldrich | Cat. #: M1404 | |
| chemical compound, drug | Isopropyl-beta-D-thiogalactoside (IPTG) | Gold Biotechnology | Cat. #: 12481C100 | Induce protein expression |
| Software, algorithm | UCSF Chimera | Pettersen et al., 2004 | RRID:SCR_004097 | https://www.cgl.ucsf.edu/chimera/ |
| Software, algorithm | MotionCorr2 | Zheng et al., 2017 | RRID:SCR_016499 | http://msg.ucsf.edu/em/software/motioncor2.html |
| Software, algorithm | GCTF | Zhang, 2016 | RRID:SCR_016500 | https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/ |
| Software, algorithm | RELION3 | Zivanov et al., 2018 | RRID:SCR_016274 | https://www3.mrc-lmb.cam.ac.uk/relion/index.php/Download_%26_install |
| Software, algorithm | Coot | Emsley and Cowtan, 2004 | RRID:SCR_014222 | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ |
| Software, algorithm | Phenix.refine | Adams et al., 2010 | RRID:SCR_014224 | https://www.phenix-online.org/documentation/reference/refinement.html |
| Software, algorithm | Graphpad prism 8.30 | Graphpad | RRID:SCR_002798 | https://www.graphpad.com/scientific-software/prism/ |
| Software, algorithm | Frealign | Grigorieff, 2016 | RRID:SCR_016733 | https://grigoriefflab.umassmed.edu/frealign |
| Other | Ni-NTA Agarose | Qiagen | Cat. #: 30230 | Recombinant protein purification |
| Other | Lipofectamine 2000 | Thermo Fisher Scientific | Cat. #: 11668019 | Mammalia cell transfection |