Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) |
Upf3b | GenBank | Gene ID: 68134 | |
| Genetic reagent (Mus. musculus) | C57BL/6J | Jackson Laboratory | Stock #: 000664 RRID:MGI:3028467 |
|
| Genetic reagent (Mus. musculus) | Upf3b-null mice | PMID:21925383 | RRID:MGI:6110148 | Miles Wilkinson lab |
| Genetic reagent (Mus. musculus) | R26-eYFP mice | PMID:11299042 | Obtained from Dr. Maike Sander (UCSD) | |
| Genetic reagent (Mus. musculus) | Omp-Cre mice | PMID:22057188 | Obtained from Dr. Haiqing Zhao (Johns Hopkins University) | |
| Genetic reagent (Mus. musculus) | RiboTag mice | PMID:19666516 | Obtained from Dr. Paul Ameiux (University of Washington) | |
| Antibody | Rabbit monoclonal anti-OMP (EPR19190) | Abcam | Cat# ab183947 RRID:AB_2858281 |
IF (1:400), WB (1:2000) |
| Antibody | Goat polyclonal anti-OMP | FUJIFILM Wako Chemicals | Cat# 544–10001-WAKO RRID:AB_2315007 |
IF (1:200) |
| Antibody | Rabbit polyclonal anti-CAMP | Generated by Richard L. Gallo laboratory | PMID:11442754 | IF (1:200) |
| Antibody | Rabbit polyclonal anti-FUT10 | Proteintech | Cat#: 18660–1-AP RRID:AB_10641997 |
IF (1:200) |
| Antibody | Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat#: A-11055 RRID:AB_2534102 |
IF (1:1000) |
| Antibody | Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 | Thermo Fisher Scientific | Cat#: A-31572 RRID:AB_162543 |
IF (1:1000) |
| Sequence-based reagent | Fosl2_F | This paper | PCR primers |
CCGCAGAAGGAGAGATGAG
(from IDT) |
| Sequenced-based reagent | Fosl2_R | This paper | PCR primers |
GCAGCTTCTCTGTCAGCTC
(from IDT) |
| Sequence-based reagent | Ptger2_F | This paper | PCR primers |
TGCTCCTTGCCTTTCACAATC
(from IDT) |
| Sequenced-based reagent | Ptger2_R | This paper | PCR primers |
CCTAAGTATGGCAAAGACCCAAG
(from IDT) |
| Sequence-based reagent | Adcy6_F | This paper | PCR primers |
TTCCTGACCGTGCCTTCTC
(from IDT) |
| Sequenced-based reagent | Adcy6_R | This paper | PCR primers |
CACCCCGGTTGTCTTTGC
(from IDT) |
| Sequence-based reagent | Ptch1_F | This paper | PCR primers |
ACCTCCTAGGTAAGCCTCC
(from IDT) |
| Sequenced-based reagent | Ptch1_R | This paper | PCR primers |
CACCCACAATCAACTCCTCC
(from IDT) |
| Sequence-based reagent | Cwc22_F | This paper | PCR primers |
CAGAAGACAGATACACAGAGCAAG
(from IDT) |
| Sequenced-based reagent | Cwc22_R | This paper | PCR primers |
CTCTCTCTCTCTCTCTGCGTTT
(from IDT) |
| Sequence-based reagent | Fut10_F | This paper | PCR primers |
CCAGGGCCTTCCTATTCTACG
(from IDT) |
| Sequenced-based reagent | Fut10_R | This paper | PCR primers |
CTGAATGTGGCCGTATGGTTG
(from IDT) |
| Sequence-based reagent | Gdpd3_F | This paper | PCR primers |
TGATCCGACACTTGCAGGAC
(from IDT) |
| Sequenced-based reagent | Gdpd3_R | This paper | PCR primers |
GCTGTGGGGTAATCGGTCAT
(from IDT) |
| Sequence-based reagent | Olfr827_F | This paper | PCR primers |
TGGGATGGTTCTTCTGGGAA
(from IDT) |
| Sequenced-based reagent | Olfr827_R | This paper | PCR primers |
ACCGTGGAGTAGGAGAGGTC
(from IDT) |
| Sequence-based reagent | Rpl19_F | This paper | PCR primers |
CCTGAAGGTCAAAGGGAATGTG
(from IDT) |
| Sequenced-based reagent | Rpl19_R | This paper | PCR primers |
CTTTCGTGCTTCCTTGGTCTT
(from IDT) |
| Commercial assay or kit | Chromium Single Cell 3' Library and Gel Bead Kit | 10X Genomics | Cat# 120237 | |
| Commercial assay or kit | iScript cDNA synthesis Kit | BioRad | Cat# 170–8891 | |
| Commercial assay or kit | SsoAdvanceD Universal SYBR Green Supermix | BioRad | Cat# 172–5274 | |
| Commercial assay or kit | RNeasy Mini Kit | Qiagen | Cat# 74104 | |
| Software, algorithm | Cell Ranger Version 2.1.1 | 10x genomics | Cell Ranger Version 2.1.1 | |
| Software, algorithm | Seurat (v3.1.5) | Designed by Rahul Satija laboratory | PMID:31178118 | |
| Software, algorithm | Monocle (v2.16.0) | Designed by Cole Trapnell laboratory | PMID:28114287 | |
| Software, algorithm | NIH ImageJ (v1.8.0) | NIH | Version 1.8.0 |