Table 3.
List of differentially expressed small RNA clusters in drought-stressed potato tubers that negatively correlate to target transcript expression. Target alignments, gene ID, expression and descriptions are included.
| Small RNA Cluster | Log2 Fold Change | Target Alignment | Target Gene | Log2-Fold Change | Protein Description |
|---|---|---|---|---|---|
| Cluster 34023 | 5.03 | AGCUCAUUAAUCUCUUCGAUA | PGSC0003DMG400009921 | −6.24 | Cysteine protease 14 |
| Cluster 23921 | 4.68 | AGGGUUCAAGAAAAUGCAUUA | PGSC0003DMG400029247 | −4.75 | Patatin group O |
| Cluster 15144 | 4.62 | AGGGUUCAAGAAAAUGCAUUA | |||
| Cluster 41775 | 4.49 | ACCUCAGGGUUCAAGAAAAUG | |||
| Cluster 83189 | 5.49 | AGGCACUGGCACUACUUCAGA | PGSC0003DMG400017091 | −4.25 | Patatin-01; Probable lipolytic |
| Cluster 83175 | 4.98 | AGCCAGUAAUAUUCACCAAGU | acyl hydrolase | ||
| Cluster 83174 | 3.45 | AGGCACUGGCACUACUUCAGA | |||
| Cluster 7920 | 4.95 | GGCAGCAAGUUCUUACAUGAC | PGSC0003DMG400008749 | −4.06 | Patatin-05; Probable lipolytic |
| Cluster 68384 | 3.01 | AUCAUUCCGGGUAUCAUUCUC | acyl hydrolase | ||
| Cluster 83190 | 2.87 | UUCCGGGUAUCAUUCUCGAAU | |||
| Cluster 83166 | 2.66 | UCCGGGUAUCAUUCUCGAAU | |||
| Cluster 68380 | 5.49 | AGGCACUGGCACUAAUUCAGA | PGSC0003DMG400014104 | −4.47 | Patatin-2-Kuras 4; Probable |
| Cluster 83164 | 5.49 | AGGCAGCUAAAUGGGGUCCUC | lipolytic acyl hydrolase | ||
| Cluster 20497 | 5.38 | CUGUUGGUGAUCCGGCGUUA | |||
| Cluster 68397 | 5.36 | GUUGCUACUGUUGGUGAUCCG | |||
| Cluster 83182 | 4.97 | GGCACUACUUCAGAGUUUGAU | PGSC0003DMG401017090 | −4.91 | Patatin-3-Kuras 1 |