REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
HRP-conjugated anti-HA	Roche	Cat# 12013819001; RRID: AB_390918
Anti-alpha-Tubulin (TUBA)	Sigma-Aldrich	Cat# T9026; RRID: AB_477593
Anti-lamin A/C (LMNA)	Cell Signaling Technology	Cat# 2032S; RRID: AB_2136278
HRP-conjugated anti-mouse IgG	Cell Signaling Technology	Cat# 7076; RRID: AB_330924
HRP-conjugated anti-rabbit IgG	Cell Signaling Technology	Cat# 7074S; RRID: AB_2099233
FITC-conjugated anti-HA	Roche	Cat# 11988506001; RRID: AB_390916
Anti-IRF3	Abcam	Cat# ab68481; RRID: AB_11155653
Alexa Fluor 546-conjugated anti-rabbit IgG	Thermo Fisher Scientific	Cat# A-11010: RRID: AB_2534077
Bacterial and Virus Strains
SeV (strain Cantell, clone cCdi)	(Yoshida et al., 2018)	GenBank accession no. AB855654
Chemicals, Peptides, and Recombinant Proteins
Dulbecco’s modified Eagle’s medium	Sigma-Aldrich	Cat# D6046-500ML
Ham’s F-12K medium	Thermo Fisher Scientific	Cat# 21127022
Fetal calf serum	Sigma-Aldrich	Cat# 172012-500ML
Penicillin streptomycin	Sigma-Aldrich	Cat# P4333-100ML
L-glutamate	Thermo Fisher Scientific	Cat# 25030081
PrimeSTAR GXL DNA polymerase	Takara	Cat# R050A
EcoRI	Takara	Cat# 1040A
XhoI	Takara	Cat# 1094A
BglII	Takara	Cat# 1021A
PEI Max	Polysciences	Cat# 24765-1
FuGENE HD transfection reagent	Promega	Cat# E2312
ProLong diamond antifade mountant with DAPI	Thermo Fisher Scientific	Cat# P36971
SuperScript III reverse transcriptase	Thermo Fisher Scientific	Cat# 18080085
DNase I, Amplification Grade	Thermo Fisher Scientific	Cat# 18047019
Power SYBR Green PCR Master Mix	Thermo Fisher Scientific	Cat# 4367659
Critical Commercial Assays
PicaGene BrillianStar-LT luciferase assay system	Toyo-b-net	Cat# BLT1000
CellTiter-Glo 2.0 assay kit	Promega	Cat# G9241
Nuclear/cytosol fractionation kit	BioVision	Cat# K266
QIAamp RNA blood mini kit	QIAGEN	Cat# 52304
Experimental Models: Cell Lines
Human: HEK293 cells	ATCC	CRL-1573
Human: A549 cells	ATCC	CCL-185
Oligonucleotides
Primers for plasmid construction, see Table S5	This study	N/A
Oligo(dT) 12-18 primer	Thermo Fisher Scientific	Cat# 18418012
GAPDH forward primer for real-time RT-PCR: ATGGGGAAGGTGAAGGTCG	This study	N/A
GAPDH reverse primer for real-time RT-PCR: GGGTCATTGATGGCAACAATATC	This study	N/A
IFNB1 forward primer for real-time RT-PCR: AAACTCATGAGCAGTCTGCA	This study	N/A
IFNB1 reverse primer for real-time RT-PCR: AGAGGCACAGGCTAGGAGATC	This study	N/A
Recombinant DNA
Plasmid: pCAGGS	(Niwa et al., 1991)	N/A
Sarbecovirus ORF3b, see Table S3	This study	N/A
IAV A/Puerto Rico/8/34 NS1	This study	GenBank accession no. EF467817.1
Plasmid: p125Luc	(Fujita et al., 1993)	N/A
Plasmid: p55C1B-Luc	(Fujita et al., 1993)	N/A
Software and Algorithms
MEGA7	(Kumar et al., 2016)	https://www.megasoftware.net
FigTree	Andrew Rambaut	http://tree.bio.ed.ac.uk/software/figtree
Sequencher version 5.1	Gene Codes Corporation	N/A
Prism	GraphPad Software	https://www.graphpad.com/scientific-software/prism/
L-INS-i in the MAFFT version 7.453	(Katoh and Standley, 2013)	https://mafft.cbrc.jp/alignment/software/
RAxML-NG v. 0.9.0	(Kozlov et al., 2019)	https://github.com/amkozlov/raxml-ng
PSORT II Prediction	(Horton and Nakai, 1997)	https://psort.hgc.jp/form2.html
Other
GISAID	Freunde von GISAID e.V.	https://www.gisaid.org
CoV-GLUE	MRC-University of Glasgow Centre for Virus Research	http://cov-glue.cvr.gla.ac.uk
Formaldehyde solution	FUJIFILM Wako Chemicals	Cat# 061-00416
Immobilon-P PVDF 0.45-μm membrane	Merck	Cat# IPVH00010
Nitrocellulose 0.20-μm membrane	Bio-Rad	Cat# 1620112