Fig. 3.

Characterization of CPW-WPC domain proteins PBANKA_1015400, PBANKA_0943400, PBANKA_1449300 and PBANKA_1218300. A: PCR diagnostic for integration of the GFP-tagged allelles into the target loci gives rise to the expected products of approximately 1.7 kb (PBANKA_1015400, primers CPW4–5’diag (AAGACAGTAAATACAATCCATAGGTC) and GFP-R (GTGCCCATTAACATCACC)); 2.4 kb (PBANKA_0943400, primers CPW1–5’diag (CCATATTATGACTTTCGAACCC) and GFP-R); 1.6 kb (PBANKA_1449300, primers CPW2–5’diag (CTTACACAAAATGGTATAAACAATTTTTC) and GFP-R); and 2.7 kb (PBANKA_1218300, primers CPW3–5’diag (CGAGTCCGAAAAGGTATACATATG) and GFP-R). B: Brightfield and fluorescence confocal images of ookinetes expressing GFP-tagged PBANKA_1015400 and PBANKA_0943400, showing localisation in focal spots associated with pigment (arrows) characteristic of crystalloids. GFP-tagged PBANKA_1449300 and PBANKA_1218300 did not show discernible GFP fluorescence (not shown). Hoechst DNA staining (blue) labels nuclei. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)