| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Percp-Cy5.5 Mouse Anti-Human CD34 (Clone 561) | Biolegend | 343612; RRID: AB_2566788 |
| PE-Cy7 Mouse Anti-Human CD38 (Clone HB7) | BD Biosciences | 335790; RRID: AB_399969 |
| PE Mouse Anti-Human CD90 (Clone 5E10) | BD Biosciences | 555596; RRID: AB_395970 |
| FITC Mouse Anti-Human CD45RA (Clone HI100) | BD Biosciences | 555488; RRID: AB_395879 |
| BV421 Rat Anti-Human CD49f (Clone GoH3) | BD Biosciences | 562598; RRID: AB_2737673 |
| Pacific Blue anti-Human CD45 (Clone HI30) | Biolegend | 304029; RRID: AB_2174123 |
| FITC anti-mouse CD45.1 Antibody (Clone A20) | Biolegend | 110706; RRID: AB_313495 |
| APC anti-mouse TER-119/Erythroid Cells Antibody (Ly-76) | Biolegend | 116212; RRID: AB_313713 |
| PE Mouse Anti-Human CD19 (HIB19) | BD Biosciences | 555413; RRID: AB_395813 |
| APC Mouse Anti-Human CD33 (WM53) | BD Biosciences | 551378; RRID: AB_398502 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Rapamycin | EMD Millipore | 553210 |
| CHIR99021 | EMD Millipore | 361559 |
| Retinoic Acid (ATRA) | Sigma | R2625 |
| StemSpan CC110 | StemCell Technologies, Inc. | 2697 |
| Cas9-NLS | UC Berkeley | NA |
| Hoechst33342 | ThermoFisher | H3570 |
| Pyronin Y | Biotang | BTBB602 |
| Primestar GXL DNA Polymerase | Takara Biosciences | R050A |
| Fixable viability stain 660 | BD Biosciences | 564405 |
| Critical Commercial Assays | ||
| FITC mouse anti-Ki67 kit | BD Biosciences | 556026 |
| FITC Annexin V Apoptosis Detection Kit with PI | Biolegend | 640914 |
| P3 primary cell 96-well nucleofector kit | Lonza | V4SP-3096 |
| Illumina MiSeq reagent kit v2 (300-cycles) | Illumina | MS-102-2002 |
| Illumina HiSeq 3000/4000 SBS kit (300 cycles) | Illumina | FC-410-1003 |
| 10X Single-cell 3′ library gel bead kit v2 | 10Xgenomics | PN-120267 |
| Deposited Data | ||
| Amplicon sequencing and single-cell RNA-sequencing datasets | This paper | BioProject ID PRJNA498122 |
| Experimental Models | ||
| Mobilized peripheral blood CD34+ Stem/Progenitor cells | AllCells | mPB015F |
| NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ (NSG) mouse | Charles River | 005557 |
| Oligonucleotides | ||
| Synthetic sgRNA targeting the HBB locus | Trilink | NA |
| FP1: cacttagacctcaccctgtg | IDT | NA |
| FP2: tatgggacgcttgatgttttct | IDT | NA |
| RP1: tatgggacgcttgatgttttct | IDT | NA |
| RP2: ctctgcctattggtctattttccca | IDT | NA |
| HBB ssODN: TCAGGGCAGAGCCATCTATTG CTTACATTTGCTTCTGACACAACTGTGTTCA CTAGCAACCTCAAACAGACACCATGGTGCA CCTGACTCCTGTAGAGAAGTCTGCGGTTACT GCCCTGTGGGGCAAGGTGAACGTGGATGAA GTTGGTGGTGAGGCCCTGGGCAGGT |
IDT | NA |
| Software and Algorithms | ||
| CRISPResso | Pinello et al., 2016 | https://github.com/lucapinello/CRISPResso |
| Seurat v3.1.4 | Butler et al., 2018; Stuart et al., 2019 | https://satijalab.org/seurat/ |
| Monocle3 v0.2.1 | Trapnell et al., 2014 | http://cole-trapnell-lab.github.io/monocle-release/monocle3/ |
| R v3.6.3 | R Development Core Team | https://www.r-project.org/ |
| Other | ||
| SFEMII | StemCell Technologies, Inc. | 09655 |
| X-VIVO15 | Fisher | BW04744Q |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.