Is it Usher Syndrome? Collaborative Diagnosis and Molecular Genetics of Patients with Visual Impairment and Hearing Loss

Abstract

Background

Usher syndrome is the most common hereditary syndrome combining deafness and blindness (1, 2). In the 2017 National Child Count of Children and Youth who are Deaf-Blind, Usher syndrome represented 329 of 10,000 children, but there were also at least 70 other etiologies of deaf-blindness documented (3). The purpose of this study was to analyze the work-up and ultimate diagnoses of 21 consecutive families who presented to the Genetic Eye-Ear Clinic (GEEC) at the University of Iowa. Our hypothesis was that most families referred to the GEEC would have initial and final diagnoses of Usher syndrome.

Materials and Methods

Patients were identified through an IRB approved retrospective chart review of referrals to the GEEC between 2012 and 2019. Details about each patient’s history, exam, and clinical and genetic work-up were recorded.

Results

From 2012 to 2019, 21 families (25 patients) were referred to the collaborative GEEC. Overall molecular diagnostic rate in this cohort was 14/21 (67%). Evaluation resulted in a change of diagnosis in 11/21 (52%) families. Ultimately, there were eleven unique diagnoses including hereditary, non-hereditary, and independent causes of combined visual impairment and hearing loss. The most common diagnosis was Usher Syndrome, which represented 6/21 (29%) families.

Conclusions

Providing a correct diagnosis for patients with visual impairment and hearing loss can be challenging for clinicians and their patients, but it can greatly improve clinical care and outcomes. We recommend an algorithm that includes multidisciplinary collaboration, careful clinical evaluation, strategic molecular testing, and consideration of a broad differential diagnosis.

Introduction

Usher Syndrome is the most common hereditary syndrome combining deafness and blindness, with a prevalence ranging from 3–6.2 per 100,000 (1, 2, 4). There are 3 subtypes based on genetic cause and phenotype, with varying levels of visual impairment due to retinitis pigmentosa (RP) and varying severities of sensorineural hearing loss (SNHL) (5, 6). There are currently 9 genes with good evidence and 3 more with conflicting or poor evidence associated with this syndrome (7). According to the 2017 National Child Count of Children and Youth who are Deaf-Blind, Usher Syndrome accounts for 329 of the 10,000 children with deaf-blindness (3). Hereditary syndromes, as a whole, accounted for 44.8% of all identified etiologies of deaf-blindness and include other syndromes, such as CHARGE syndrome, Down syndrome, Stickler syndrome, Dandy-Walker syndrome, and Goldenhar syndrome. Each of these syndromes has a unique constellation of features, some of which may overlap or have variable expressivity. Some, like Usher syndrome, are largely restricted to the sensory systems, while others, like CHARGE syndrome, have multi-system involvement. (8). Of note, there are over 70 specific etiologies of deaf-blindness reported in the National Child Count of Children and Youth who are Deaf-blind. The majority of these other etiologies fit under the following broad categories; complications from prematurity, infections, and injuries (3). Therefore, although a child referred to a specialist with visual impairment and hearing loss may have a presumptive diagnosis of Usher syndrome, there are many diverse etiologies to consider, lending to a complicated clinical and molecular diagnostic process.

When evaluating a patient with visual impairment and hearing loss, it is important to remember that these individuals face many barriers and are at risk of feeling isolated and/or depressed (9–11). An accurate diagnosis helps to provide each patient with the appropriate resources and services to help overcome these barriers. For example, diagnosing a patient with Usher syndrome type 1 offers the possibility of cochlear implants and early detection of RP (12, 13). The clinician can then help to arrange services in school and at home to assist the individual. In addition, correct molecular diagnosis is a prerequisite for several gene therapy trials that are underway for Usher syndrome type 1 (14–17). With a proper diagnosis, the clinician can more accurately treat symptoms, provide guidance for additional testing and monitoring, provide assistive resources, discuss family planning, and educate on expectations and prognosis.

At the University of Iowa, we have established a Genetic Eye-Ear Clinic (GEEC), with the purpose of providing the most accurate and efficient clinical and molecular diagnosis for patients with visual impairment and hearing loss. The purpose of this retrospective chart review was to analyze the work-up and ultimate diagnoses of 21 consecutive families who presented to the GEEC from 2012 through 2019. We hypothesized that the majority of the patients seen in the GEEC would be referred with, and confirmed to have a diagnosis of Usher syndrome. However, we were also aware that there are many other etiologies to consider. Therefore, we also analyzed the number families that received a change in diagnosis through evaluation in this multidisciplinary diagnostic clinic.

Materials and Methods

Collaborative clinic

The GEEC consists of a half-day clinic every quarter in which a pediatric otolaryngologist (Richard Smith, MD) and a pediatric ophthalmologist (Arlene Drack, MD) see patients together as a single care team. Ancillary staff consisted of a nurse and genetic counselor. Patients undergo testing as deemed appropriate by each provider, and additional work-up as necessary based on the collaborative process. In accordance with their clinical evaluation, each patient underwent at least one molecular diagnostic test. If the first test was negative or inconclusive, further testing was pursued (table 2).

Table 2.

Molecular genetic testing for 25 patients seen by the Genetic Eye-Ear Clinic

Fam#	ID#	Result	Diagnostic Molecular Test	Negative Molecular Genetic Tests
1	1	ACTG1: NM_001199954:c.173C>T, p.Ala58Val chr17:79479119:G>A	OtoSCOPE	N/A
2	2	Negative to date	-	OtoSCOPE negative
3	3	MYO7A: NM_000260:c.471–2A>C; NM_000260:c.983T>C, p.Leu328Pro chr11:76867704:A>C; chr11:76869456:T>C	OtoSCOPE	N/A
4	4 5 6 7	USH2A: NM_206933:c.10561T>C, p.Trp3521Arg; NM_007123:c.2299delG chr1:215956104:A>G; chr1:216420437:C>-	OtoSCOPE Sanger Segregation Sanger Segregation, CMA Sanger Segregation	N/A
5	8	SOX10: heterozygous gene deletion Breakpoints undefined	OtoSCOPE	CEI Waardenburg panel negative
6	9	Negative to date	-	OtoSCOPE negative; Harboyan syndrome testing negative; mtDNA testing negative; SLC4A11 deletion/duplication negative; CMA normal
7	10	Negative to date	-	OPA1 testing negative, CMA normal
8	11	CACNA1F: NM_005183.3 c.2506_2508delinsCTCCTGCAGGATGG chrX:49076161:AAC>CCAT CCTGCAGGAG	John and Marcia Carver Lab Exome	OtoSCOPE negative, LCA panel negative, SECORD panel negative
9	12	OPA1: NM_015560.2:c.1334G>A; p.R445H chr3:193361785:G>A	GeneDx Optic Atrophy Nuclear Gene panel	OtoSCOPE negative
10	13	Negative to date	-	CMA, Fragile X, Prevention Genetics, and Waardenburg panel all negative
11	14	USH2A: NM_206933:c.7595–3C>G; NM_007123:c.2299delG chr1:216062399:G>C; chr1:216420437:C>-	OtoSCOPE	N/A
12	15	AIFM1: NM_001130846:c.211G>A, p.Val71Ile chrX:129270058:C>T	OtoSCOPE	Friedreich ataxia, SCA, AOA1, Lesch-Nyhan syndrome, CMA, TNR (including Fragile X), and Lysosomal storage panel all negative
13	16	CDH23:NM_022124:c.4242_4243insCAG; NM_022124:c.5924–2A>C chr10:73498287:->CAG; chr10:73550043:A>C	OtoSCOPE	GJB2/6 negative
14	17	MITF: NM_198159.1:c.971G>A, p.Arg324His chr3:70005639:G>A	Boston University Waardenburg Panel	Karyotype normal, CMA normal
15	18 19	USH2A: NM_206933:c.4714C>T, p.Leu572Phe; NM_007123:c2299delG chr1:216270469:G>A; chr1:216420437:C>-	OtoSCOPE	N/A
16	20	Negative to date	-	OtoSCOPE Negative
17	21	USH2A:NM_206933.2;c.1416_1441delTACCCCATCTCTTCAAGAGTTCGTAA,p.Asn472LysfsTer17, Exon 46 deletion Chr1:316496924; TTTACGAACTCTTGAAGAGATGGGGTA>T Exon 46 deletion	OtoSCOPE	N/A
18	22	ANKRD11: heterozygous for 10.81kb deletion within ANKRD11 (NM_013275.5), ISCN:arr[hg 19]16q24.3(89,329,540–89,340,345)x1	CMA	N/A
19	23	PEX1: Variant 1: 7:92119090:G>A, NM_000466.2:c.3574C>T, p.Gln1192Ter; Variant 2: 7:92123671:A>G, NM_000466.2:c.2966T>C, p.Ile989Thr; Variant 3: 7:92134096:G>A, NM_000466.2:c.2021C>T, p.Pro674Leu.	OtoSCOPE	N/A
20	24	PENDING	-	OtoSCOPE PENDING
21	25	PENDING	-	CYP1B1 negative, OtoSCOPE PENDING

Patients

Patients were identified through an IRB approved retrospective chart review of sequential referrals to the GEEC between 2012 and 2019.

Data collection

As part of a retrospective chart review, all electronic medical records of patients presenting to the GEEC between 2012–2019 were evaluated to collect initial diagnosis at referral, symptoms, medical and family histories, physical exam findings, diagnostic testing performed, additional medical specialties consulted, and clinical and molecular diagnoses at the date of data gathering.

Results

From 2012 to 2019, 21 families (25 patients) were referred to the collaborative GEEC. Of these families, 8/21 (38%) were referred with an initial diagnosis of Usher syndrome, 8/21 (38%) were referred with nonspecific diagnoses, and 5/21 (24%) were referred with an initial diagnosis of another syndrome (See Table 1). Of the families referred with an initial diagnosis of Usher syndrome, five had molecular testing suggesting this diagnosis, and three families had not yet had molecular testing. One of these families presented with only one mutation in an Usher gene, and therefore this information was used to buttress the final diagnosis. In the GEEC, each patient was evaluated for visual impairment, hearing loss, and any other pertinent physical findings. Relevant past medical history, family history, and a detailed family pedigree were obtained (Table 1). Testing and evaluation were driven by clinical indications and patient and family wishes.

Table 1.

Clinical course summary for 25 patients seen by the Genetic Eye-Ear Clinic

Fam #	ID	F/M	Age	Initial Diagnosis	Family History	Past Medical History and Physical Exam	Final Diagnosis
*1	1	F	11	HL, early onset esotropia & myopia	3 generations w/ variable esotropia, coloboma, and ADHD. Father w/ ptosis, atypical epicanthus, and seizure disorder.	Postlingual b/l mod SNHL, congenital esotropia, trochlear nerve palsy, small optic nerve/ tortuous vessels, atypical epicanthus w/ low insertion on the nasal bridge, thin upper lip, long philtrum, learning disabilities	Baraitser-Winter Syndrome
2	2	F	10	HL & 4th cranial nerve palsy	No FH of HL	Postlingual u/l mod-profound SNHL; esotropia, 4th cranial nerve palsy, abn horizontal semicircular canal u/l on CT scan	Superior oblique palsy w/ u/l hearing loss
3	3	M	3	Usher syndrome, 1	Extended FH of HL, no FH of VL	Congenital b/l profound SNHL, pigmentary retinopathy, delayed motor milestones, blonde fundus	Usher syndrome, 1B
4	4 5 6 7	M M M F	3 6 5 7	Usher syndrome, 2A	Siblings w/ HL	Congenital b/l mild-mod SNHL. No VL to date. Patient 6 w/ joint laxity and developmental delay compared to siblings.	Usher syndrome, 2A
*5	8	F	5	Usher syndrome, 2C	Extended FH of HL, anisocoria, and white forelock, no FH of VL	b/l profound SNHL, amblyopia, esotropia, heterochromia, anisocoria	Waardenburg syndrome
*6	9	F	13	Cogan syndrome & HL	1st cousin w/ HL, no FH of autoimmunity	Postlingual b/l mod-severe SNHL, photophobia, corneal clouding, cataract. Possible immunological involvement, false positive HSV	Harboyan Syndrome
7	10	M	8	Optic atrophy & HL	Cousin w/ optic neuropathy, MGM blind @ 19yo (presumed congenital toxoplasmosis)	Postlingual b/l low-nml HL, esotropia, optic nerve hypoplasia, decreased vision, developmental delay, systolic murmur, dolichocephaly, broad nose w/ bifid groove, high-arched palate, mild micrognathia	Optic nerve hypoplasia
*8	11	M	12	Leber congenital amaurosis/retinal dystrophy w/ mild-mod HL	Uncle w/ childhood nystagmus, no FH of HL	Postlingual b/l mild SNHL, vestibular dysfunction, delayed motor milestones, nystagmus, torticollis, photosensitivity, decreased vision, postnatal NICU stay w/ ampicillin & gentamicin exposure	Congenital stationary night blindness
*9	12	F	14	Usher syndrome	Grandmother w/ optic atrophy, deafness, balance problems, extended FH of HL and VL	Postlingual b/l severe auditory neuropathy, optic atrophy and pallor, ataxia, poor balance	Dominant optic atrophy plus syndrome
*10	13	M	3	Nystagmus & HL	No FH of HL or VL (father adopted), FH of developmental delay	Prelingual b/l mild SNHL, Hx of ampicillin, gentamicin, nystatin exposure, congenital nystagmus, photophobia, delayed motor milestones, heterochromia	Waardenburg syndrome
11	14	M	2	Usher syndrome, 2A	No FH of congenital HL or VL	Congenital b/l mod SNHL, slight retinal pigment stippling, nyctalopia	Usher syndrome, 2A
*12	15	M	32	Cerebellar ataxia (recessive ataxia) w/ ocular apraxia	No FH of cerebellar ataxia, cousin w/ strabismus & amblyopia. Mother and Grandmother with high arches.	Postlingual b/l mod-severe HL, ocular motor apraxia, optic atrophy, posterior pole drusenoid dots, and nystagmus, axonal neuropathy and cerebellar ataxia, volitional tremor, dysarthria, intellectual disability	Cowchock syndrome
13	16	M	6	Usher syndrome, 1	Father colorblind, mother w/ autoimmunity	Congenital b/l severe-profound SNHL, delayed motor milestones, photophobia, optic disc pallor	Usher Syndrome, 1D
*14	17	M	8	Nystagmus & HL	No FH of HL or vision loss, Father w/ premature greying of hair	Congenital b/l mod-severe to profound SNHL, nystagmus, photophobia, hypopigmented iris	Waardenburg syndrome
15	18 19	F M	8 7	Usher syndrome, 2A	Siblings w/HL	Congenital b/l severe SNHL. PE otherwise nml. No VL to date.	Usher syndrome, 2A
*16	20	M	38	Ocular albinism	No FH of HL or VL	HL early teens, deafness by age 31. Balance issues, short stature. Cataracts in early childhood, chronic corneal edema, iris TIDs, optic nerve pallor, attenuated retinal vessels, retinal pigment stippling	Syndromic Retinitis Pigmentosa
17	21	M	8mo	Usher syndrome, 2À	No FH of HL or VL	Congenital b/l moderate SNHL	Usher syndrome, 2A
*18	22	F	15mo	Seizure and hearing loss	No FH of HL or VL	Focal epilepsy, hydronephrosis, dysmorphic facies, progressive hearing loss, convex optic nerves.	KBG Syndrome
*19	23	M	54	Retinitis Pigmentosa, sensorineural hearing loss, kidney disease	No FH of HL or VL but Mother with chronic kidney disease	Proteinuric kidney disease stage 4, post-lingual b/l severe SNHL, tremor, VL diagnosed in teens. Retina with hyperpigmented nummular clumps and bone spicules, attenuated arterioles, situs inversus.	Heimler/Zellweger spectrum disorder
20	24	M	10	Excessive Blinking	No FH of HL or VL	Congenital b/l profound SNHL, speech disorder, excessive blinking. PE otherwise nml.	PENDING
21	25	F	8	Congenital glaucoma, left eye and u/l hearing loss	Mom with u/l hearing loss since childhood. No FH VL.	u/l moderate conductive hearing loss, congenital glaucoma left eye, buphthalmos, large left corneal diameter, haab striae	Congenital Glaucoma

Abbreviations: Fam#-family number; ID-patient ID number; F-female; M-Male; HL-hearing loss; VL-vision loss; w/-with; FH-family history; b/l-bilateral; u/l-unilateral; abn-abnormal; nml-normal; SNHL-sensorineural hearing loss; PE-physical exam; HSV-herpes simplex virus; Hx-history; TID-transillumination defects

^*Indicates that the patient received a change in diagnosis after being evaluated by the GEEC

Overall molecular diagnostic rate in this cohort was 14/21 (67%) (Table 2), with an additional seven patients still under investigation. Of the seven patients under investigation, six were given clinical diagnoses based on their presentation. The last patient under investigation presented with excessive blinking and profound bilateral SNHL, with no diagnosis given at this time. The combination of careful clinical evaluation and strategic molecular diagnosis resulted in a change of diagnosis in 11/21 (52%) families (Table 1). Of these families that underwent a change in diagnosis, 2/21 (9.5%) were referred with an initial diagnosis of Usher Syndrome.

The most common molecular test utilized for this cohort was OtoSCOPE® (https://morl.lab.uiowa.edu/clinical-diagnostics/deafness-otoscope/otoscope-genetic-testing), which is a genetic test utilizing next generation sequencing and read depth analysis to test for 152 genes known to cause non-syndromic hearing loss, Usher syndrome, Pendred syndrome, and other hearing loss-related phenotypes. It investigates both single nucleotide variants and copy number variations. Variants are called using in silico and literature searches in a Multidisciplinary Hearing Meeting. Ten of the 21 families received a molecular diagnosis using OtoSCOPE testing. Additional tests utilized were whole exome sequencing, disease specific panels, and chromosome microarray (CMA) (by the John and Marcia Carver Nonprofit Genetic Testing Laboratory, University of Iowa; Boston University; GeneDx; and the University of Iowa cytogenetics laboratory, respectively). Familial variant testing was used for patients in the same family.

The most frequent final diagnoses included Usher syndrome (6/21) and Waardenburg syndrome (3/21). All of the Usher Syndrome patients had molecularly confirmed diagnoses, and two of the three Waardenburg patients had molecularly confirmed diagnoses. The last Waardenburg patient received a clinical diagnosis based on three clinical features of the syndrome, given all molecular testing has been negative to date (Table 2). Other diagnoses included optic atrophy plus syndrome, Baraitser-Winter Syndrome, Superior oblique palsy and unilateral hearing loss, Harboyan syndrome, congenital stationary night blindness with hearing loss due to aminoglycoside exposure, Cowchock syndrome, optic nerve hypoplasia, Syndromic RP, congenital glaucoma, KBG syndrome, and Heimler/Zellweger spectrum disorder (Tables 1 and 2). Overall, this resulted in 29% of families presenting to the GEEC having a final diagnosis of Usher Syndrome, 14% with Waardenburg syndrome, 34% with various other hereditary syndromes, 19% with independent, unrelated causes of hearing and vision loss, and 4.8% with an unknown diagnosis at this time.

Discussion

A multidisciplinary genetic eye and ear clinic allows for active discussion of patients from both the ophthalmologist’s and otolaryngologist’s perspectives and efficient evaluation of a patient in the context of multiple systems at once. The GEEC has provided an avenue through which to unify in-depth clinical analysis with molecular diagnosis. This retrospective review showed that Usher syndrome was the most common initial and final diagnosis for families presenting to the GEEC. However, it is important to note that the prevalence of Usher syndrome in the GEEC (29%) is much higher than the prevalence of Usher syndrome in all patients with hearing and visual impairment, which is described as 3–6% in the literature (1). We believe this is because the GEEC is purely a subspecialty diagnostic clinic, with a limited number of patients. Therefore, other patients with hearing and vision loss due to a known cause such as neonatal infection, prematurity, or other more common genetic syndromes such as Down syndrome, are not referred to this clinic. Instead, these patients are often followed in a general ophthalmology clinic, otolaryngology clinic, or genetics clinic. Also, the GEEC is still growing and as more patients are referred, the proportion of Usher Syndrome may change. Although Usher syndrome was the most common initial and final diagnosis, it is also important to note that 11/21 (52%) of families underwent a change in diagnosis because of the evaluation in the GEEC. Two of these families were referred with an initial diagnosis of Usher Syndrome. Therefore, careful evaluation in this type of clinic proved beneficial to many of the patients and their families.

The cases from this retrospective chart review highlight several important considerations that should be taken when approaching a patient with visual impairment and hearing loss. First, one must acknowledge the importance of early diagnosis. Early diagnosis provides multiple benefits to patients and their families, including early monitoring and intervention, prognosis, education, and family planning. In order to give an accurate diagnosis at the earliest point in time, careful clinical evaluation and strategic molecular testing must be employed. The health care team should be persistent in providing a diagnosis with good correlation between the molecular and clinical findings. Within this process, it is important to keep in mind a broad differential diagnosis including rare syndromes and independent causes of visual impairment and hearing loss. We will demonstrate how these considerations affected the diagnostic process of the families in this study.

Importance of Early diagnosis

In this study, the individuals in family number 4 (patients 4–7) were referred to the GEEC with suspected Usher syndrome type 2. A careful, but efficient clinical evaluation confirmed this diagnosis in all 4 patients. In Usher syndrome type 2, RP does not begin to develop until the second or third decade (5, 6). Therefore, these children will be carefully monitored for early signs of night blindness and cystoid macular edema (CME). CME develops in up to 25% of patients with Usher syndrome type 2 and causes decreased central vision (18). Early treatment of CME can improve acuity and may help prevent additional photoreceptor damage (18, 19). Regular monitoring and assessment of their visual function will allow the provider to help optimize their education and safe ambulation. As stated previously, an early diagnosis can also lead to the opportunity to participate in clinical trials, including those focused on gene replacement therapy.

Correlation of Clinical Evaluation and Strategic Molecular Testing

In this study, patient 8 exemplifies the importance of correlating careful clinical evaluation with strategic molecular testing. This patient was first referred to the GEEC with a diagnosis of hearing loss and amblyopia, labeled as Usher syndrome type 2C, because of identification of 2 ADGRV1 variants on molecular testing. Careful evaluation of the ADGRV1 variants showed that one of the reported variants exhibited a minor allele frequency greater than 0.5% in 3 of 6 small control populations and 0.35% in the European (Non-Finnish) population of the ExAC database (http://exac.broadinstitute.org/variant/5-89925039-A-C). Therefore, this variant was a benign polymorphism and not disease-causing. The other variant was a known disease-causing mutation, but because Usher syndrome is autosomal recessive, one disease causing mutation does not make the diagnosis. In addition, the hearing loss in this patient had been of earlier onset and more severe than typical for ADGRV1 related-disease. This led to reassessment of the diagnosis and a meticulous complete eye examination, which revealed subtle iris heterochromia (Figure 1a). A more in-depth family history identified individuals with white forelocks and hearing loss (Figure 1b). The patient was also found to have absent semicircular canals, which is not a feature of Usher syndrome. All of these features are in fact, features of Waardenburg syndrome. This resulted in a change in the clinical diagnosis from Usher syndrome to Waardenburg syndrome. Initial evaluation with a Waardenburg syndrome panel was negative. Testing with OtoSCOPE® v7 was positive for a SOX10 heterozygous deletion (Figure 1c), which is a previously reported cause of both Waardenburg syndrome 2E and 4C (20). Persistence and continued evaluation based on family history, clinical examination, and available molecular genetic testing resulted in a significantly revised diagnosis for this patient. Usher syndrome leads to progressive profound vision loss and often blindness, while Waardenburg syndrome is associated with stable, normal visual acuity in most people. Additionally, Usher syndrome is autosomal recessive, while Waardenburg syndrome is autosomal dominant. Therefore, the implications of such a diagnostic change were significant for this family (5, 6).

Figure 1 (a,b,c).

Patient 8 presented to the GEEC with an initial diagnosis of Usher syndrome 2C. Thorough exam discovered slight iris heterochromia (a), detailed family history displayed hearing loss, vestibular dysfunction, iris heterochromia, white forelocks, and other pigmentary abnormalities (b). Molecular genetic evaluation with OtoSCOPEv7 identified a partial heterozygous SOX10 deletion on copy number analysis (c) as the likely cause of Waardenburg syndrome within this family.

Investigation of Rare Syndromes

Patient 1 was referred with myopia, esotropia, and post-lingual bilateral moderate SNHL. She was initially tested with OtoSCOPE v4, expecting either a negative result or to identify an isolated cause of hearing loss. She was diagnosed with non-syndromic SNHL due to a novel variant in ACTG1. However, a family history of combined vision-hearing loss was obtained and when other family members were examined, the diagnosis was changed to autosomal dominant Baraitser-Winter syndrome (21). The characteristic picture of Baraitser-Winter syndrome includes distinctive facial features such as hypertelorism, ptosis, short stature, structural brain abnormalities that can lead to seizures, ear abnormalities and hearing loss, heart defects, and abnormalities of the kidneys (21). Patient 1 did not fit this characteristic picture, but rather exhibited only sensorineural hearing loss, slight hypertelorism, and congenital esotropia. Her father has hearing loss, slight hypertelorism, coloboma, seizures, esotropia, ptosis, and carries the same mutation in ACTG1. Her paternal grandmother has hearing loss and seizures. The proband manifests a phenotype that is compatible with Baraitser-Winter syndrome, but without all the features, while her father displays a more stereotypical phenotype. Kemerley, et al. previously reported this three-generation pedigree segregating the novel mutation in ACTG1 causing Baraitser-Winter Syndrome with extremely variable expressivity (21). Therefore, this syndrome may have an even broader definition and clinical variability than previously anticipated, and should be considered when investigating a patient with visual impairment and hearing loss. Lastly, this example also shows the importance of correctly diagnosing syndromes that involve additional organ systems that may require screening and/or monitoring. Because Baraitser-Winter syndrome can involve seizures, this patient can be screened for any sign of seizure activity.

Consideration of Independent Causes

When evaluating a patient with multiple syndromic features, a clinician may hope to identify a single unifying genetic cause, but this is not always the case. Patient 11 (Table 1) was referred to the GEEC because he exhibited hearing loss, vestibular dysfunction, decreased vision, nystagmus, and abnormal color vision. His electroretinogram (ERG) had decreased rod function with a scotopic bright flash with a low b:a ratio electronegative pattern, and completely attenuated waveforms on photopic testing, suggesting the diagnosis of a retinal dystrophy (22). Molecular genetic testing to investigate a genetic cause of his hearing loss initially showed two Usher mutations, but in different genes. The case was discussed at length between ophthalmology and otolaryngology, and it was noted that neither his retinal dystrophy nor his audiogram was typical of Usher Syndrome. Continued investigation showed that the patient also tested negative for genes in the LCA (Leber’s Congenital Amaurosis) panel. Finally, targeted exome panel sequencing for a broad spectrum of known retinal genes was performed and identified a truncating variant in CACNA1F, which causes the ERG findings found in this patient, and facilitated the final diagnosis of synaptic retinal disorder/congenital stationary night blindness. Investigation of his past medical history identified a NICU stay in the early postnatal period with aminoglycoside exposure, which is associated with hearing loss and vestibular dysfunction, fitting more closely with his clinical picture (23, 24). This case shows the importance of considering independent causes of combined visual impairment and hearing loss.

In conclusion, there are many hereditary, non-hereditary, and independent causes of visual impairment and hearing loss to consider when asking the question, “Is it Usher syndrome?”. The wide variety of etiologies can make the diagnostic process challenging for clinicians and their patients. Ultimately, a correct diagnosis at the earliest time point possible can greatly improve clinical care and outcomes. We believe that a multidisciplinary diagnostic clinic for patients with visual impairment and hearing loss allows for efficient and accurate diagnoses. We recommend a collaborative evaluation, allowing insights of multiple specialists to contribute to the active diagnostic discussion (Figure 2). Within this diagnostic process, the specialists should keep in mind a broad differential diagnosis of combined vision and hearing loss, and strive for good correlation of clinical evaluation and strategic molecular testing, with the ultimate goal of providing the best resources and care available to patients.

Figure 2.

Diagnostic pathway for patients presenting to the Genetic Eye and Ear Clinic. This figure highlights the collaborative process during evaluation as well as the need to correlate clinical evaluation and targeted molecular testing, while keeping in mind a broad differential diagnosis. The ultimate goal is early and accurate diagnosis for each patient.